Concept explainers
Interpretation:
The severity of DNA mutation that produced in the given changes in mRNA codons has to be compared.
Concept Introduction:
Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when
Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.
Some amino acids and their corresponding mRNA codons are listed below,
Start codon is a codon that specifies the start of RNA translation.
Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
Fund. of General, Org... -Masteringchem.
- Explain the term mutation.arrow_forwardRefer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardClassify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a.) AGC (ser): ________b.) UGU (cys): ________c.) GGC (gly): _______d.) UGA (stop): _______e.) UUC (phen): _______arrow_forward
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardDefine the following terms: genetic code, codon, and anticodon. What is the relationship among the bases in DNA, the codons of mRNA, and the anticodons of tRNA?arrow_forwardRefer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forward
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardA mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.arrow_forwardSelect any one type of genetic mutation and explain it with the help of related Disorder?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning