![EBK FUNDAMENTALS OF GENERAL, ORGANIC, A](https://www.bartleby.com/isbn_cover_images/8220102895805/8220102895805_largeCoverImage.jpg)
EBK FUNDAMENTALS OF GENERAL, ORGANIC, A
8th Edition
ISBN: 8220102895805
Author: Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 27.49CP
Interpretation Introduction
Interpretation:
The base sequence which would be sticky with the given sequence should be written.
Concept Introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Draw each of the following base pairs: A-T, G-C, and U-A
Identify the FOUR sequence.
Which of the following sequences is less
favorable to find in a folded beta?
Select one:
a.l-V-A-I-G-P-L-A-V-F-Y
b. G-A-L-V-F-C-V-I-L-L-P
c. E-V-A-I-I-F-M-D-G-V-A
d. A-V-G-I-L-P-L-A-V-F-Y
e.A-A-V-L-L-A-I-G-L-M-W
Chapter 27 Solutions
EBK FUNDAMENTALS OF GENERAL, ORGANIC, A
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…arrow_forwardIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterarrow_forwardIn the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forward
- Match the shorter sequence relative to the longer one. Note: Observe Chargaff's rule of base pairing Longer sequence: T C A C G A T C A G C T C G A A G C A C Shorter sequence: T C G T G Clue: More than one correct answerarrow_forwardFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forwardDNA sequences have an alphabet {A,C,G,T}. How many DNA sequences of length n are there? (Two DNA sequences are the same if one is the reverse of the other).arrow_forward
- For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forwardWrite the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGarrow_forwardThe genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…arrow_forward
- Simply put, what is DFR stand for?arrow_forwardIn the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGarrow_forwardEach of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY