Concept explainers
Interpretation:
The structure of a DNA-Bound bZIP transcription factor should be explained.
Concept introduction:
The structure is determined by five transcription factors. Each transcription factor is a member of special structural category. Representation of novel and unlooked-for DNA-binding motifs is done by TFIID TATA-binding super molecule. Determination of the structure of -bound super molecule is done by the exception of TFIID.Acknowledgement of specific
Answer to Problem 18P
C/EBP
Separating the sequence of the macromolecule before every essential amino acid residue gives:
Rearranging the sequence to allow 2 additional seven residue sequence gives:
Explanation of Solution
An essential amino acid zipper can also be represented in coiled-coil domain. It contains
C/EBP
Separating the sequence of the macromolecule before every essential amino acid residue gives:
This is often followed by a two residue repeats and 2 additional seven residue repeats. These 2 seven residue repetition begin the twenty eight residue essential amino acid zipper. Rearranging the sequence to allow 2 additional seven residue sequence gives:
The essential amino acid residues of the essential amino acid zipper are residues 48, 55, 62, and 69. Essential amino acid residue 76 might also participate within the essential amino acid zipper. All of those residues are on the C-terminal aspect of the chain along with the essential amino acid zipper.
An essential amino acid zipper could be a coiled-coil domain. Coiled-coil domains repeat each seven residues, thus we tend to expect one domain of the 1GU4 -helices to possess essential amino acid residues repetition each seven residues. Essential amino acid zipper domain contains 28 amino acids, thus we can expect four such repeats. The first essential amino acid repeat could be a seven residue repeat.
This is often followed by a two residue repeat and 2 additional seven residue repeats.
Want to see more full solutions like this?
Chapter 29 Solutions
Owlv2, 4 Terms (24 Months) Printed Access Card For Garrett/grisham's Biochemistry Technology Update, 6th
- Comparing the Mechanisms of Action of EF-Tu/EF-Ts and DnaK/ GrpE (Integrates with Chapter 30.) In what ways are the mechanisms of action of EF-Tu/EF-Ts and Dna K/GrpE similar? What mechanist ic functions do the ribosome A-site and DnaJ have in common?arrow_forwardAlternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?arrow_forwardmain binding pocket inside the GLP-1 receptor and the critical residues found in GLP-1 particularly in its N-terminus. what are the amino acids found particularly in its N terminusarrow_forward
- Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.arrow_forwardSpecificity in fusion between vesicles involves two discrete and sequential processes. Describe the first of the two processes and its regulation by GTPase switch proteins. What effect on the size of early endosomes might result from overexpression of a mutant form of Rab5 that is stuck in the GTP-bound state?arrow_forwardBinding of --------- identifies the decoding center of the ribosome.arrow_forward
- Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.arrow_forwardRNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?arrow_forwardGal 4 is involved in the regulation of galactose metabolism. Describe how transcription would be affected in the presence of a mutation that resulted in an inability of Gal80 to enter the nucleus?arrow_forward
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?arrow_forwardSearch about transcription elongation factor P-TEFb with its relationship with CDK9 and RNA Pol II, what is the role of this particular transcription elongation factor compared with other general transcription factors and explain the mechanism on how eukaryotic transcription is controlled by the roles of this transcription factor (be specific on reaction or modification on RNA Pol II, which domain as you learn from the research article) and integrate the concept of chromatin remodeling in terms of packaging of DNA, and accessibility of the template for the RNA polymerase https://advances.sciencemag.org/content/6/50/eabc1450/tab-pdfarrow_forwardEF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning