Concept explainers
Interpretation: The sequence of the DNA coding strand and DNA template strand for the following mRNA sequence should be determined:
5’-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3’
Concept introduction:
DNA stores genetic information in a stable form that can be readily replicated.
The template strand is DNA strand from which mRNA is built and it serves as a template for transcription. It runs in a 3’ to 5’ direction.
The DNA strand which is not used as template for transcription is said to be a coding strand as it corresponds to the same sequence as that of mRNA, the only difference is instead of thymine, uracil is present in mRNA strand.
Answer to Problem 1P
For the given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
Explanation of Solution
If the left chain is the coding chain, one reads from the 5’ end above downwards. So, the code is read as ‘…ATTGC…’ in this small part of the gene.
The template strand and the coding strand are complementary to each other, that is for each ‘A’ on the coding strand there is a ‘T’ on the template strand. For every ‘G’ on the coding strand there is a ‘C’ on the template strand. As in
Thus, the answer, the sequence for the coding strand for given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
For the given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
Want to see more full solutions like this?
Chapter 29 Solutions
Biochemistry 8e & Launchpad (twelve Month Access) (hardcover)
- Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?arrow_forwardINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A Carrow_forwardCalculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.arrow_forward
- drop down choices: - functional - non functional - no transcriptionarrow_forwardQuestion:- Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E coll release factors 1 and 2 (RF1 and RF2) c. 5' methyl-guanosine cap d. Ribosomal P sitearrow_forward- cytogenetics- Give me an example of make up a crime scene scenario in which DNA from a nonhuman provided critical evidence.arrow_forward
- Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.arrow_forwardCOMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCarrow_forwardPLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this? arrow_forward
- RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardBacteria or Eukaryotes? Formation of a termination loop within the transcript Alternative splicing of transcripts Translation beginning before transcription is complete Cleavage following the AAUAAA signal Direct binding of RNA polymerase to promoterarrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning