BIOCHEMISTRY 2 TERM ACCESS
9th Edition
ISBN: 9781319402877
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 29, Problem 9P
Interpretation Introduction
Interpretation:
The reason due to which the activation of telomerase gene causes cell to become cancerous needs to be explained.
Concept introduction:
Telomerase is the enzyme responsible for repair of the extend of telomeres. Telomerase regulates check on tumor cells. These are made up of proteins and RNA subunits.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
True or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low
concentrations and RNA synthesis at higher concentrations.
NH2
H.
он
Cordycepin (3'-deoxyadenosine)
a. What is the basis of inhibition by cordycepin?
b. Why is poly(A) synthesis more sensitive than the synthesis of other
RNAS to the presence of cordycepin?
c. Does cordycepin need to be modified to exert its effect?
Chapter 29 Solutions
BIOCHEMISTRY 2 TERM ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardClose contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?arrow_forwardTrue or False. De-acetylation of histone tails allows nucleosomes to pack together into tighter arrays, which usually reduces gene expression. Explain your answer in 1-2 sentences.arrow_forward
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardDisdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur in the initiation and elongation of DNA replication in S phase.arrow_forwardYes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?arrow_forward
- organisms ha varieties. Through this process, several genetically (10) been produced. What I Can Do Activity 7: MATCHY MATCHY Direction: Match the purpose to the components found in the box below. Antibiotic Resistance Gene Multiple Cloning Site Promoter DNA Inserted Gene Sequence Multiple Cloning Site 1. Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g., beta-galactosidase; heat treatment (~65°"C) 2. DNA sequence or portion for the insertion of the desired gene. This section may contain sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) 3. Successful insertion of a gene allows the expression of its protein product. This usually provides a specific trait to the "transformed" bacteria. 4. Provides a way to screen a population of bacteria for those that took up the plasmid. For example, if an ampicillin resistance gene is encoded in the plasmid, then only bacteria 10 t4arrow_forwardQuestion. The function of FG-nucleoporins within the nuclear pore complex is to: shield large, hydrophilic, unchaperoned proteins from entering the nucleus. prevent small, hydrophobic proteins from entering the nucleus. cleave the nuclear localization sequence (NLS) from the protein to be imported. aid GAP in the hydrolysis of GTP to GDP. All of the above. Question 5, Ultimately, the entire process of nuclear protein import is driven by: the concentration gradient of the imported protein across the nuclear membrane. the localization of Ran FG-nucleoporins in the nuclear pore complex (NPC) GTP hydrolysis None of the above Question 6 During the process of nuclear import, a GEF works in the: cytoplasm to exchange GTP for the GDP bound to Ran cytoplasm to use GTP to release Ran from importin nucleus to exchange GTP for the GDP bound to Ran nucleus to activate the intrinsic GTPase activity of Ranarrow_forwardtraffic deaths in 10 years. Does daylight savings time increase the number of traffic deaths? (Many countries are in the process of getting rid of the time change - even though the Senate did vote to stop the time change the legislation seems to have stalled (as usual!)). 6) Epistasis is a phenomenon in which one gene controls the expression of another. In one case, a dihybrid cross should yield a 9:3:4 ratio. You collect the following data on mice: black coat: 218 Is there any reason to doubt the ratio of 9 black: 3 brown : 4 white? brown coat: 76 white coat: 89arrow_forward
- Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardPlease help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license