Starting Out With C++ From Control Structures Through Objects, Student Value Edition (8th Edition)
8th Edition
ISBN: 9780133778816
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 15RQE
The__________ library function returns the cosine of an angle.
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule04:01
Students have asked these similar questions
Nee dpythin create a function that calculates the sum and average of the odd numbers that you read from the file.
C++ format please, thanks
Write a function named "FriendsWithPets" that takes a const reference to a std::map of my friends names (std::string) to the number of pets they own (int) and returns the number of friends (int) that have at least one pet.
You should be using the STL algorithms to achieve this and no looping (no "while" or "for" keywords anywhere in the solution).
#include<map>
#include<algorithm>
#include<iostream>
#include<regex>
Military to Regular Time
Create a function called MilitaryToRegularTime that converts time in the military time format into the regular format. For example, convert 2249 to 10:49 pm.
The function should receive a single int parameter that represents the military time. It should return a std::string that contains the regular time counterpart of the given military time.
Please see the sample output below to guide the design of your program.
Note: Consider possible edge cases in user input to ensure your program works correctly.
Sample output:
Please enter the time in military time: 1433 The equivalent regular time is: 2:33 pm
Make sure that you examine the MilitaryToRegularTime function prototype in time_converter.h, implement it in time_converter.cc, and call it from inside of main.cc. You'll find that skeleton code has already been provided and you simply need to call the function, which can be called from inside main.cc because we include the header file via: #include…
Chapter 3 Solutions
Starting Out With C++ From Control Structures Through Objects, Student Value Edition (8th Edition)
Ch. 3.1 - Prob. 3.1CPCh. 3.1 - Prob. 3.2CPCh. 3.1 - Assume value is an integer variable. If the user...Ch. 3.1 - A program has the following variable definitions....Ch. 3.1 - Prob. 3.5CPCh. 3.1 - Complete the following program skeleton so it asks...Ch. 3.2 - Complete the table below by determining the value...Ch. 3.2 - Write C++ expressions for the following algebraic...Ch. 3.2 - Prob. 3.9CPCh. 3.2 - Complete the following program skeleton so it...
Ch. 3.5 - Assume the following variable definitions: int a =...Ch. 3.5 - Complete the following program skeleton so it asks...Ch. 3.5 - Prob. 3.13CPCh. 3.6 - Write a multiple assignment statement that assigns...Ch. 3.6 - Write statements using combined assignment...Ch. 3.6 - Prob. 3.16CPCh. 3.7 - Write cout statements with stream manipulators...Ch. 3.7 - Prob. 3.18CPCh. 3.7 - The following program skeleton asks for an angle...Ch. 3.9 - Prob. 3.20CPCh. 3.9 - Assume the variables angle1 and angle2 hold angles...Ch. 3.9 - To find the cube root (the third root) of a...Ch. 3.9 - The cosecant of the angle a is 1sina Write a...Ch. 3 - Assume the following variables are defined: int...Ch. 3 - Prob. 2RQECh. 3 - Prob. 3RQECh. 3 - Complete the following table by determining the...Ch. 3 - Write C++ expressions for the following algebraic...Ch. 3 - Assume a program has the following variable...Ch. 3 - Assume a program has the following variable...Ch. 3 - Assume qty and salesReps are both integers. Use a...Ch. 3 - Rewrite the following variable definition so that...Ch. 3 - Complete the following table by providing...Ch. 3 - Write a multiple assignment statement that can be...Ch. 3 - Write a cout statement so the variable divSales is...Ch. 3 - Write a cout statement so the variable totalAge is...Ch. 3 - Prob. 14RQECh. 3 - The__________ library function returns the cosine...Ch. 3 - The ___________ library function returns the sine...Ch. 3 - The ________ library function returns the tangent...Ch. 3 - The __________ library function returns the...Ch. 3 - The _________ library functionreturns the...Ch. 3 - The _________ library function returns the natural...Ch. 3 - Prob. 21RQECh. 3 - The _______ library function returns the value of...Ch. 3 - The _________ libraryfunction returns the square...Ch. 3 - The ________ file must beincluded in aprogramthat...Ch. 3 - A retail store grants its customers a maximum...Ch. 3 - Write a pseudocode algorithm for a program that...Ch. 3 - Write a pseudocode algorithm for a program that...Ch. 3 - using namespace std; int main () { double number1,...Ch. 3 - #include iostream using namespace std; int main()...Ch. 3 - #include iostream; using namespace std; int main()...Ch. 3 - #include iostream; using namespace std; main { int...Ch. 3 - #inc1ude iostream; using namespace std; main {...Ch. 3 - #inc1ude iostream; using namespace std; int main()...Ch. 3 - What will each of the following programs display?...Ch. 3 - #include iostream using namespace std; int main()...Ch. 3 - (Assume the user enters George Washington.)...Ch. 3 - (Assume the user enters 36720152. Use a...Ch. 3 - Miles per Gallon Write a program that calculates a...Ch. 3 - Stadium Seating There are three seating categories...Ch. 3 - Test Average Write a program that asks for five...Ch. 3 - Average Rainfall Write a program that calculates...Ch. 3 - Ingredient Adjuster A cookie recipe calls for the...Ch. 3 - Box Office A movie theater only keeps a percentage...Ch. 3 - How Many Widgets? The Yukon Widget Company...Ch. 3 - How Many Calories? A bag of cookies holds 30...Ch. 3 - How Much Insurance? Many financial experts advise...Ch. 3 - Automobile Costs Write a program that asks the...Ch. 3 - Celsius to Fahrenheit Write a program that...Ch. 3 - Currency Write a program that will convert U.S....Ch. 3 - Monthly Sales Tax A retail company must file a...Ch. 3 - Property Tax A county collects property taxes on...Ch. 3 - Senior Citizen Property Tax Madison County...Ch. 3 - Math Tutor Write a program that can be used as a...Ch. 3 - Interest Earned Assuming there are no deposits...Ch. 3 - Monthly Payments The monthly payment on a loan may...Ch. 3 - Pizza Pi Joes Pizza Palace needs a program to...Ch. 3 - Angle Calculator Write a program that asks the...Ch. 3 - Stock Transaction Program Last month Joe purchased...Ch. 3 - Word Game Write a program that plays a word game...
Additional Engineering Textbook Solutions
Find more solutions based on key concepts
Given that y=ax3+7, which of the following are correct Java statements for this equations? int y = a x (x x +...
Java How To Program (Early Objects)
Consider the following code (and assume that it is embedded in a complete and correct program and then run): st...
Problem Solving with C++ (10th Edition)
3.12 (Date Create a class called Date that includes three pieces Of information as data
members—a month (type ...
C++ How to Program (10th Edition)
Consider the previous question, but include + or letter grades. A+ is 4.25, A is 3.75, B+ is 3.25. B is 2.75, ...
Java: An Introduction to Problem Solving and Programming (8th Edition)
Why is it useful for a programmer to have some background in language design, even though he or she may never a...
Concepts of Programming Languages (11th Edition)
Computers process data under the control of sets of instructions called
Java How to Program, Early Objects (11th Edition) (Deitel: How to Program)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Computer Science R programming Adjust your functions to take into account upper and lower case letters, as well as spaces. Bonus: can your functions also deal with special characters. Apply your first function to the variable x1 and then the second function to your output, so you can convert it back. x1 <- "Hello My Friend" x2 <- "This: Is, Comma: Horror!"arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward// LargeSmall.cpp - This program calculates the largest and smallest of three integer values. #include <iostream> using namespace std; int main() { // This is the work done in the housekeeping() function // Declare and initialize variables here int largest; // Largest of the three values int smallest; // Smallest of the three values // Prompt the user to enter 3 integer values // Write assignment, add conditional statements here as appropriate // This is the work done in the endOfJob() function // Output largest and smallest number. cout << "The largest value is " << largest << endl; cout << "The smallest value is " << smallest << endl; return 0; }arrow_forward
- USING C++ Please fix the errors in the code (image attached) with the failed test warning (image attached). Thank you! Write a program that removes all non-alphabetic characters from the given input. Ex: If the input is: -Hello, 1 world$! the output is: Helloworld Your program must define and call the following function that takes a string as a parameter and returns the string without any non-alphabetic characters.string RemoveNonAlpha(string userString)arrow_forward3. Intermediate CodeThe following statement is known:A = - A * (A + B ) - (B – C) / DPlrase make: c. Triplesarrow_forwardJI need help with my c++ code for a flower here is my code: #include<iostream>#include<iomanip>using namespace std;// function to print the menuvoid printMenu(){cout<<"Program 1: Gladiolus"<<endl;cout<<"Choose from among the following options:"<<endl;cout<<"1. Display original graphic"<<endl;cout<<"2. Display Gladiolus"<<endl;cout<<"3. Exit the program"<<endl;}// function to print given number of white spacesvoid printSpaceForward(int count){for(int i = 1; i <= count; i++)cout<<":";}// function to display gladiolus flower with given number of sectionsvoid displayGladiolus(int sections){// level of sectionsfor(int i = 1; i <= sections; i++){printSpaceForward(sections);cout<<"---"<<endl;// print the upper part of a level, upto the '@' character level for(int j = 1; j <= i; j++) { printSpaceForward(sections-i); printSpaceForward(i-j); cout<<"("; printSpaceForward(j); if(i==j)…arrow_forward
- def pay(hours, pay_rate): pay = hours * pay_rate print(f'pay is ${pay:.2f}') Identify the statements that correctly call the pay function. Select ALL that apply. print(pay(40,15.00) pay(40,15.00) week_pay = pay(40,15.00) hrs = 32rate = 18.50print(pay(hours,pay_rate) )arrow_forward(General math) a. Write a function named rightTriangle() that accepts the lengths of two sides of a right triangle as the arguments a and b. The subroutine should determine and return the hypotenuse, c, of the triangle. (Hint:UsePythagorastheorem,c2=a2+b2.) b. Include the function written for Exercise 4a in a working program. The main() function should call rightTriangle() correctly and display the value the function returns.arrow_forwardFlowchart, create. #include <iostream>using namespace std;// Write function declaration here void multiplyNumbers(int, int, int &);int main(){ int num1 = 10; int num2 = 20; int product = 0; // Print value of product before function call cout << "Value of product is: " << product << endl; // Call multiplyNumbers using pass by reference for product multiplyNumbers(num1, num2, product); // Print value of calculated product cout << num1 << " * " << num2 << " is " << product << endl; return 0;} // End of main function// Write multiplyNumbers function here; use pass by reference for result of multiplication. Then use pass by address. void multiplyNumbers(int n1, int n2, int &result) { result = n1*n2;}arrow_forward
- C++ Angle Calculator Write a program that asks the user for an angle, entered in radians. The program should then display the sine, cosine, and tangent of the angle. (Use sin, cos, and tan library functions to determine these values.) The output should be displayed in fixed-point notation, rounded to four decimal places of precision.arrow_forward// HouseSign.cpp - This program calculates prices for custom made signs. #include <iostream> #include <string> using namespace std; int main() { // This is the work done in the housekeeping() function // Declare and initialize variables here // Charge for this sign // Color of characters in sign // Number of characters in sign // Type of wood // This is the work done in the detailLoop() function // Write assignment and if statements here // This is the work done in the endOfJob() function // Output charge for this sign cout << "The charge for this sign is $" << charge << endl; return(0); }arrow_forwardUSE C++ ONLY <IOSTREAM> THANK YOU 2. Write a lunch order program which allows to select lunch items accordingto the lunch menu provided below. (B) Burger with French Fries – 8.99 (C) Chicken and Rice – 9.50 (T) Tuna Sandwich – 10.49 (E) Exita) Write a function void takeOrder(int& burger, int& chicken, int& tuna);which will display the menu item, validate the entries and count how manyorders for each menu item: - Request one character for a lunch item. Menu options must be case insensitive (i.e. ‘E’ and ‘e’ must work). - Validate the input value. - Handle the menu (with a switch statement) to record how many orders for each item is taken. - The function must use pass by reference parameters to return how many orders for each menu item. - End the function only if Exit option is selected.b) Write a function payOrder(int burger, int chicken, int tuna) to print out how many orders are taken for each menu and calculate the total price.c) Call the functions in main() as…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrC++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning
functions in c programming | categories of function |; Author: Education 4U;https://www.youtube.com/watch?v=puIK6kHcuqA;License: Standard YouTube License, CC-BY