BIOCHEMISTRY 2 TERM ACCESS
9th Edition
ISBN: 9781319402877
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 24P
Interpretation Introduction
Interpretation:
The auto radiograph of some bacterial gene is to be described.
Concept introduction:
Auto radio graph is technique through which visualization of radioactively labeled molecule can be done. Generally, it is done on a X- ray film. In bacterial DNA, one gene can be transcribed for many RNAs at a particular time.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the
MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter
abbreviation.
ANTI-CODON
3'
5'
SEQUENCE
AMINO ACID
N-
C-
SEQUENCE (3 letter terminus
Abbreviation)
Terminus
AMINO ACID
N-
C-
SEQUENCE (1 letter terminus
Abbreviation)
Terminus
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
Question 8
Review translation. Match the term and its description. Each term can only be used once.
This site holds the tRNA that carries the growing polypeptide chain
| Choose )
This site holds the tRNA that carries the next amino acid to be
| Choose J
added to the chain
This site is the exit site, where discharged tRNAS leave the
[ Choose )
ribosome
Initiation, elongation and termination
| Choose J
>
Chapter 30 Solutions
BIOCHEMISTRY 2 TERM ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forwardRNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and which ING strandarrow_forwardTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAarrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forward
- Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forward
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license