Answered: RNA sequence. ate 3' and 5' ends on…

Science

Biology

RNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and which ING strand

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Related questions

Q: IV. CENTRAL DOGMA OF MOLECULAR Suppose the following base sequence was found in a 30-base polymer:…

A: Central Dogma: Central dogma is a process by which information from DNA is converted into…

Q: Maintenance methyltransferases recognize: CG sequences O CC sequences O CA sequences O CT sequences…

A: Question - Maintenance methyltransferases recognize: CG sequences CC sequences CA sequences CT…

Q: Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other…

A: The helicase is the protein complexes that are known to separate the DNA strands using the ATP as an…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: Difference between DNA PURIFICATION and RNA PURIFICATION

A: DNA and RNA are nucleic acids, that are made up of nucleotides.DNA is double-stranded and RNA is a…

Q: ength of the double helix

A: Gene: The gene is a sequence of nucleotides in DNA or RNA which encodes the synthesis of a gene…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…

A: There are three options to be read as True and False and are answered and corrected in Step 2

Q: Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino…

A: Proofreading refers to a mechanism for correcting errors in the translation process. It helps to…

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: Review translation. Match the term and its description. Each term can only be used once. transfer…

A: Hi, Thanks For Your Question. transfer amino acids to the growing polypeptide in a ribosome…

Q: A mutation called base substitution mutation had been altered the sequence in a. eliminated the…

A: Base substitution is a type of mutation in which one nucleotide base is substituted by the other and…

Q: Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In…

A: Nucleotide is the basic building block of nucleic acids. RNA and DNA are long chains of nucleotides.…

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: rRNA sequence analysis: c. Other than RNA sequence, what other sequence can be determined by this…

A: RNA sequence analysis is used to find the sequence of nucleotide base pairs on the RNA strand.

Q: about transcription a

A: Answer: Depending on the promoter, either strand of DNA can be used as the template strand.The…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…

A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…

Q: 1)(recall) Which of the following SEQUENCES BEST DESCRIBES the flow of information thet take place…

Q: e transfer-RNA and the amino acid structure attached to 5' 10

A: In molecular biology and genetics,translation is a process which comes after transcription and in…

Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…

A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…

Q: Review translation. Match the term and its description. Each term can only be used once. This site…

A: Translation is the process in which proteins are synthesized from single strand of mRNA . For this ,…

Q: Protein Synthesis Article In this activity, you will write an artide explaining, in everyday…

A: Before we proceed to the details of protein synthesis let us first know what proteins are and why…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: A lot of time and energy put into creating tRNAs; why?

A: A transfer RNA is a kind of RNA molecule that helps to match an mRNA codon with the amino acid it…

Q: tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon…

A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…

Q: Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: protein synthesis 2 When the DNA sequence TGACT is copied to RNA, the sequence in RNA will be Select…

A: The Central Dogma of Molecular Biology shows that DNA is converted into RNA, which further makes…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: REPLICATION TRANSCRIPTION TRANSLATION Substrate a) ribonucleotides a) phosphates b) ribonucleotides…

A: Replication is the process of DNA synthesis and to synthesize DNA we require deoxyribonucleotides…

Q: a) Complete the table below. Assume that reading is from left to right and that the columns…

A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…

Q: I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a…

A: Proteins or peptides are composed of twenty standard amino acids attached together via peptide…

Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…

A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…

A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…

Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…

A: DNA is a long, double-stranded, helical molecule composed of building blocks called…

Q: How many moles of ATP and GTP are required to synthesize a mole of a polypeptide 100 amino acids…

A: In protein biosynthesis, amino acids are activated by the binding of a specific tRNA molecule and…

Q: A protein produced by bacteria is 300 amino acids long. Compute for the number of nucleotides in the…

A: Proteins are made up of amino acids that are bonded together by peptide bonds. Proteins are…

Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…

A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…

Q: Calculating Transformation Efficiency

A: Transformation is the process in which bacteria take up the foreign DNA/genetic material and such…

Q: Quick help Only cell biology Which process is described in the following paragraph? During DNA…

A: DNA contains the instructions for an organism's or cell's development, reproduction, and death. DNA…

Q: JSmol Backbone Side groups Color Reset The first beta strand in primary sequence starts with residue…

A: Beta sheet is one of the motifs of secondary structure of protein. Each beta sheet is formed by beta…

Q: INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a.…

A: In cells, DNA is present as genetic material that codes for mRNA, and mRNA in turn codes for the…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…

Q: Different types of mutations and how to use the genetic code table.

A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…

Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…

A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…

Q: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEW DNA REPLICATION Fill in the complementary DNA…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…

Q: Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying…

A: Central dogma means the flow of information occurs from DNA to RNA, and RNA to proteins. Proteins…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

RNA sequence.
ate 3' and 5' ends on BOTH strands
ate which strand served as the TEMPLATE strand and which
ING strand

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and pyrimidine Hydrogen bonding between purine and pyrimidine bases Hydrogen bonding between adjacent pyrimidine bases tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
Remember remove the introns! All introns start with GT and end with AG.
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Evidence that each nucleotide is partof only one codon EXPLAIN
Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.
The direction of movement of RNA polymerase along the template to generate supercoiled structures in reference to the given figure and whether supercoils would be generated if RNA polymerase were free to rotate about the DNA axis.
rRNA sequence analysis: c. Other than RNA sequence, what other sequence can be determined by this method?
VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?