![BIOCHEMISTRY-ACHIEVE (1 TERM)](https://www.bartleby.com/isbn_cover_images/9781319402853/9781319402853_largeCoverImage.gif)
BIOCHEMISTRY-ACHIEVE (1 TERM)
9th Edition
ISBN: 9781319402853
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 36, Problem 8P
Interpretation Introduction
Interpretation:
The velocity of the helicase and the kinesin should be compared.
Concept introduction:
The helicase is an enzyme. This enzyme is involved in the separation of the DNA double helix at the time of replication. The kinesin is a class of motor protein in eukaryotic cells. They are powered by the ATP molecules in the cells and they move along the microtubule filaments.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low
concentrations and RNA synthesis at higher concentrations.
NH2
H.
он
Cordycepin (3'-deoxyadenosine)
a. What is the basis of inhibition by cordycepin?
b. Why is poly(A) synthesis more sensitive than the synthesis of other
RNAS to the presence of cordycepin?
c. Does cordycepin need to be modified to exert its effect?
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to-
3'5'-to-3' direction. Other helicases have been reported to move in
the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why
you would expect helicases to move in one direction or the other?
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
Chapter 36 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Please help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardproteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forward
- Tyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forward
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forwardSuggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forward
- . Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forwardC- PETT-1 PETT-2 It seems PETT-2 worked better than PETT-1. Examine each structure carefully. Provide plausible reasons for the differences in these compounds inhibiting their target enzyme, reverse transcriptase. How might you improve the efficacy of PETT-1 and PETT-2?arrow_forwardPlease select appropriate word in each bracket Many anti-cancer drugs affect nucleotide metabolism and inhibit DNA synthesis. For example, a widely used anti-cancer agent, 5-fluorouracil, is a pyrimidine analog that is incorporated into nucleotide form and affects DNA synthesis by inhibiting the activity of [ Select ] ["thymidine kinase", "ribunucleotide reductase"] , the enzyme required to synthesize [ Select ] ["dTMP", "dUMP"] . This inhibition of DNA replication affects both cancer and normal cells, and hence there are serious side effects of these agents including [ Select ] ["immune system suppression", "hyperallergenic reaction"] and damage to the [ Select ] ["lining of the GI tract", "connective tissue of cartilage"] . Methotrexate, was the first drug to actually cure a cancer, choriocarcinoma, in 1958, and serves to block the activity of [ Select ] ["dihydrofolate reductase", "serine hydroxymethyl-transferase"] , another enzyme required for the synthesis of dTMP.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license