BIO 2340 ANATOMY-INCLUSIVE ACCESS PT.1
15th Edition
ISBN: 9781260675986
Author: SHIER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4, Problem 6IA
Consider the following DNA sequence:
CATGTGTAGTCTAAA
a. Write the sequence of the DNA strand that would bereplicated from this one.
b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.
c. State how many codons the sequence specifies.
d. State how many amino acids the sequence specifies.
e. Use table 4.2 to write the sequence of amino acids that thisDNA sequence encodes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four different bases. How many possible unique codons are there?b. If DNA had only two types of bases instead offour, how long would codons need to be to specify all20 amino acids?
consider dna nucleotide sequence ATCGGATCGA What structure of dna does the sequence represent?
Chapter 4 Solutions
BIO 2340 ANATOMY-INCLUSIVE ACCESS PT.1
Ch. 4 - Prob. 1PCh. 4 - 2 What type of molecule is formed by the anabolism...Ch. 4 - Distinguish between dehydration synthesis and...Ch. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - 21 Define genetic code.
Ch. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - 26 Explain how genetic information is carried from...Ch. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Distinguish between anabolism and catabolism. (p....Ch. 4 - Prob. 2CACh. 4 - Prob. 3CACh. 4 - 4 Describe how an enzyme interacts with its...Ch. 4 - Prob. 5CACh. 4 - Prob. 6CACh. 4 - Prob. 7CACh. 4 - 8 Explain the importance of a rate-limiting...Ch. 4 - Prob. 9CACh. 4 - Prob. 10CACh. 4 - Prob. 11CACh. 4 - Prob. 12CACh. 4 - Prob. 13CACh. 4 - Explain how the oxidation of molecules inside...Ch. 4 - Prob. 15CACh. 4 - Prob. 16CACh. 4 - Prob. 17CACh. 4 - Prob. 18CACh. 4 - Prob. 19CACh. 4 - Prob. 20CACh. 4 - Prob. 21CACh. 4 - Distinguish among a gene, an exome, and a genome....Ch. 4 - Define gene expression. (p. 132)Ch. 4 - Prob. 24CACh. 4 - Prob. 25CACh. 4 - Prob. 26CACh. 4 - Prob. 27CACh. 4 - Prob. 28CACh. 4 - Prob. 29CACh. 4 - Prob. 30CACh. 4 - Prob. 31CACh. 4 - Prob. 32CACh. 4 - Prob. 33CACh. 4 - Prob. 34CACh. 4 - Prob. 35CACh. 4 - Prob. 36CACh. 4 - Prob. 37CACh. 4 - Discuss three ways that the genetic code protects...Ch. 4 - How can the same molecule be both a reactant...Ch. 4 - Prob. 2IACh. 4 - Prob. 3IACh. 4 - Prob. 4IACh. 4 - Prob. 5IACh. 4 - Consider the following DNA sequence:...Ch. 4 - Prob. 7IA
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the central dogma of molecular biology, explain the terms replication, transcription and translationarrow_forwardIf the sequence in the coding strand of DNA for a particular amino acid is 5'AGT3', then the anticodon on the corresponding tRNA would be ? Explain how to do thisarrow_forwardEvaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…arrow_forward
- A. Give five important features of the DNA molecule? B. How does the DNA structure reflect its functions?arrow_forwardUse the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?arrow_forwardThe image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forward
- Using the figure below identify: What is a function of introns and exons? What is a role of mobile DNA elements? What is a meaning of simple-sequence DNA?arrow_forwardUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationarrow_forwardCompare and contrast exons and intronsarrow_forward
- Which is a difference between B-DNA and A-DNA? A. For polynucleotide strands containing the same number of nucleotides, the B-DNA strand will be shorter from end-to-end than the corresponding A-DNA. B. Both are helical, but B-DNA is right-handed and A-DNA is left-handed. C. The sugar in A-DNA is more oxidized than that in B-DNA D. Helical structures in RNA predominantly adopt the B-DNA conformation. E. None of the above. The tetranucleotide AGTC (in DNA) has a free hydroxyl group on ____. A. A B. G, T, and C C. C D. A, G, T, and Carrow_forwardDraw a simple schematic of a tRNA molecule showing its two "business" ends.arrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY