ANATOMY AND PHYSIOLOGY THE UNITY OF FORM
9th Edition
ISBN: 9781264807123
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.2, Problem 10BYGO
Summary Introduction
Introduction:
DNA is a genetic material consisting of a long stretch of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.
Use the first photo to answer the following questions.
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
Chapter 4 Solutions
ANATOMY AND PHYSIOLOGY THE UNITY OF FORM
Ch. 4.1 - What are the three components of a nucleotide?...Ch. 4.1 - What governs the pattern of base paring in DNA?Ch. 4.1 - what is the difference between DNA and chromatin?Ch. 4.1 - Summarize the structural and functional...Ch. 4.1 - The general name of the monomers that compose DNA...Ch. 4.1 - Prob. 2AYLOCh. 4.1 - Prob. 3AYLOCh. 4.1 - How DNA and protein are combined to form...Ch. 4.1 - Prob. 5AYLOCh. 4.1 - HOW RNA differs from DNA in structure and...
Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Describe the roles of RNA polymerase ribosomes,...Ch. 4.2 - What is the difference between genetic...Ch. 4.2 - Summarize the processing of a protein from the...Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Prob. 1AYLOCh. 4.2 - Prob. 2AYLOCh. 4.2 - The organization of nucleotides into DNA triplets;...Ch. 4.2 - How the genetic code relates mRNA codons to...Ch. 4.2 - The process and outcome of genetic transcription,...Ch. 4.2 - Prob. 6AYLOCh. 4.2 - Prob. 7AYLOCh. 4.2 - Prob. 8AYLOCh. 4.2 - Prob. 9AYLOCh. 4.2 - Prob. 10AYLOCh. 4.3 - Describe the genetic roles of DNA helicase and DNA...Ch. 4.3 - Explain why DNA replication is called...Ch. 4.3 - Define mutation. Explain why some mutations are...Ch. 4.3 - Prob. 14BYGOCh. 4.3 - Prob. 15BYGOCh. 4.3 - Prob. 16BYGOCh. 4.3 - Prob. 1AYLOCh. 4.3 - Semiconservative replication, the enzymes that...Ch. 4.3 - What a mutation is and how a cell detects and...Ch. 4.3 - The four stages of the cell cycle, what occurs in...Ch. 4.3 - Prob. 5AYLOCh. 4.3 - Cytokinesis and how it overlaps but differs from...Ch. 4.3 - Prob. 7AYLOCh. 4.3 - Prob. 8AYLOCh. 4.4 - Why must the carrier of a genetic disease be...Ch. 4.4 - Prob. 18BYGOCh. 4.4 - Prob. 19BYGOCh. 4.4 - Prob. 1AYLOCh. 4.4 - Organization of the karyotype; the number of...Ch. 4.4 - Prob. 3AYLOCh. 4.4 - Prob. 4AYLOCh. 4.4 - Prob. 5AYLOCh. 4.4 - Why a recessive trait can skip a generation, with...Ch. 4.4 - The differences between the genotype, genome, and...Ch. 4.4 - Prob. 8AYLOCh. 4.4 - Prob. 9AYLOCh. 4.4 - Prob. 10AYLOCh. 4.4 - Prob. 11AYLOCh. 4.4 - Prob. 12AYLOCh. 4.4 - Why it cannot be said that dominant alleles are...Ch. 4.4 - Prob. 14AYLOCh. 4.4 - Prob. 15AYLOCh. 4 - Production of more than one phenotypic trait by a...Ch. 4 - When a ribosome reads a codon on mRNA, it must...Ch. 4 - Prob. 3TYRCh. 4 - Two genetically identical strands of a metaphase...Ch. 4 - Prob. 5TYRCh. 4 - Genetic transcription is performed by a....Ch. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Semiconservative replication occurs during a....Ch. 4 - Mutagens sometimes cause no harm to cells for all...Ch. 4 - The cytoplasmic division at the end of mitosis is...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - Prob. 16TYRCh. 4 - Prob. 17TYRCh. 4 - The cytoplasmic granule of RNA and protein that...Ch. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWTSCh. 4 - Steroids, carbohydrates, and phospholipids are...Ch. 4 - Prob. 3WWTSCh. 4 - Prob. 4WWTSCh. 4 - Prob. 5WWTSCh. 4 - The law of complementary base pairing describes...Ch. 4 - Prob. 7WWTSCh. 4 - All mutations result m the production of defective...Ch. 4 - Prob. 9WWTSCh. 4 - Prob. 10WWTSCh. 4 - Why world the supercoiled, condensed form of...Ch. 4 - Prob. 2TYCCh. 4 - Given the information in this chapter, present an...Ch. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the complementary mRNA nucleotide monomers, b) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the anti-codons of tRNA, c) The interaction with the cell membrane, d) All of these e) None of these are correctarrow_forwardIn eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?arrow_forwardAnswer the following questions: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA Ligase C) DNA Gyrase D) RNA Polymerase III E) Reverse Transcriptase 2. Which of the following has only one equivalent codon? A) Ala B) Arg C) Val D) Trp E) Gly 3. Which of the following does not describe transcription? A) Synthesis of RNA using DNA as the template B) Requires DNA-dependent RNA Pol C) Highly selective process that is strictly regulated D) A step in gene expression E) None of the above 4. Peptide bond formation happens in _____ site. A) A B) P C) E D) L E) Barrow_forward
- 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.arrow_forward14) Why are telomeres so important in eukaryotic organisms? A) Without telomeres, important DNA could be lost every time the cell divides. B) They cap the mRNA, allowing it to pass through the nuclear membrane to the cytoplasm fo translation. C) They provide a repetitive DNA sequence needed by primers to recognize the beginning of transcription. D) They remain relatively undamaged from environmental stress and toxins.arrow_forwardWhich of the following terms is used for the various forms of any one a) Autosomes b ) Codons c) Allelt e ) Homozygousarrow_forward
- According to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.arrow_forwardWhich of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.arrow_forwardGalactosemia is a metabolic disorder characterized by the inability to metabolize the sugar galactose. People with galactosemia suffer from liver, kidney, and brain damage among other symptoms. A gene mutation underlying galactosemia was identified by sequencing the genome of a person with galactosemia. What additional evidence would support the hypothesis that the mutation in the candidate gene causes the disease?arrow_forward
- As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardWhy might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal protein mutations than other cell types?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY