BIOLOGY W/MASTERINGBIOLOGY MOD >B<
11th Edition
ISBN: 9780134846156
Author: Campbell
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 5, Problem 5.6CR
Summary Introduction
To determine: The similarity in the gene sequence between humans and fruit flies, fish, and mice.
Introduction: The organisms are classified into different groups on the basis of their similarities. The animal kingdom is classified into vertebrates and invertebrates. The vertebrates are further divided as fish, amphibians, reptiles, birds, and mammals based on their features. The more closely related groups have a higher similarity in their gene sequences.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If a sequence from another species showed a 96 percent sequence similarity to humans, would that species be more or less closely related to humans than chimpanzees are?
Explain why the sequences of these two genes are similar to each other but not identical.
Discuss why it is useful to search a database to identify sequencesthat are homologous to a newly determined sequence.
Chapter 5 Solutions
BIOLOGY W/MASTERINGBIOLOGY MOD >B<
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - DRAW IT Go to Figure 5.23a and, for the top three...Ch. 5.5 - DRAW IT In a DNA double helix, a region along one...Ch. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Which of the following categories includes all...Ch. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Knowledge Booster
Similar questions
- A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forwardthe difference between the model of the white-eyedfly’s DNA sequence and the model of the red-eyed fly’s DNA sequence?arrow_forwardMobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what ways could the presence of an Alu sequence affect a nearby gene?arrow_forward
- A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana. How would you expect their DNA sequences to relate?arrow_forwardIn genomes the potential duplicate/paralog share the same annotation but have lower sequence similiarity. Discuss what could have caused this difference and its possible driver.arrow_forwardThe A+T:G+C ratios in DNA of cattle and rat are very similar. Would you expect the +RNAs, rRNAs, mRNAs of the two species to be very similar? Explainarrow_forward
- Approximately what portion of the human genome is composed of repeat sequences?arrow_forwardConserved gene order observed in the chromosomes of two distantly related organisms provides evidence of a(n) _____ relationship between genes.arrow_forwardWhen comparing evolutionary similarities between different genes within a gene family, it is usually more straightforward to compare genes by using the protein sequences of gene products rather than DNA sequences of the genes themselves. Explain why this is the case. (Write 5 points)arrow_forward
- A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.arrow_forwardThe following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forwardExplain why many traits encoded by mtDNA and cpDNA exhibit considerable variation in their expression, even among members of the same family.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning