![Campbell Biology: Custom Edition](https://www.bartleby.com/isbn_cover_images/9781323717271/9781323717271_smallCoverImage.jpg)
Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5.4, Problem 3CC
WHAT IF? Ø Where would you expect a polypeptide region rich in the amino acids valine, leucine, and isoleucine to be located in a folded polypeptide? Explain.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
(a) Tropomyosin, a 70-kDa muscle protein, is a two-stranded α -helical coiled coil. Estimate the length of the molecule. (b) Suppose that a 40- residue segment of a protein folds into a two-stranded antiparallel β structure with a 4-residue hairpin turn. What is the longest dimension of this motif?
Where would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine to be located in a folded polypeptide? explain
Chapter 5 Solutions
Campbell Biology: Custom Edition
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - DRAW IT Go to Figure 5.23a and, for the top three...Ch. 5.5 - DRAW IT In a DNA double helix, a region along one...Ch. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Which of the following categories includes all...Ch. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
The term ‘spore’.
Biology Science Notebook
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Remembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet point alternately above and below the plane of the sheet, consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg- Leu-Lys-Ile-Arg-Phe-Glu. Do you find anything remarkable about the arrangement of the amino acids in this sequence when incorporated into a β sheet? Can you make any predictions as to how the β sheet might be arranged in a protein?arrow_forward. Assume that some protein molecule, in its folded native state, has one favored conformation. But, when it is denatured, it becomes a "random coil," with many possible conformations. (a) What must be the sign of AS for the change: native → denatured? (b) How will the contribution of AS for native → denatured affect the favorability of the process? What apparent requirement does this impose on AH if proteins are to be stable structures?arrow_forward(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forward
- Consider the following peptide to answer the questions below: A M A K K E S H I F T A I D E What is the total charge of this peptide at pH = 5? What is the N terminal amino acid (full name)? C terminal amino acid? How many fragments would result if this peptide underwent proteolytic cleavage with V-8 protease and what are these fragments (list them)? Would this peptide be a candidate to form an alpha helix? Why or why notarrow_forwardWhat is a helix-turn-helix motif? secondary structure in which an α helix is separated from a β sheet by a loop supersecondary structure in which an α helix is separated from another α helix by a turn supersecondary structure in which a β sheet is separated from a helix by a turn secondary structure in which two right-handed α helices are intertwined secondary structure in which two left-handed α helices are intertwinedarrow_forwardTwo peptide segments are shown below. Predict which one would have the most negative AG when going from an unfolded to a folded structure. Justify your choice. (i) Gly-Ala-Asn-lle-Val-Trp-Leu-Glu-Met-Phe-Val-Pro OR (ii) Ala-Gly-Lys-lle-Arg-Tyr-Thr-Cys-Val-Glu-Met-Serarrow_forward
- Peptides and small proteins fold spontaneously in aqueous solution at room temperature. Thus, for a small protein in water, we can say ΔG FOLD < 0. Denoting the unfolded protein as Unf and the folded protein as Fld, we can write the following equation:Unf(aq)--DELTA G FOLD----> Fld(aq)Considering the transition from the unfolded state (in which there are many possible conformations) to the folded state (only one conformation), there is clearly a decrease in the entropy of the protein. However, protein folding is (correctly) described as an entropically driven process.a) Resolve this apparent paradox by identifying the enthalpy (ΔH) and entropy (−TΔS)components involved in protein…arrow_forwardConsider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?arrow_forwardGT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Metarrow_forward
- SYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions between two different proteins. SYNZIP1 is around 47 amino acids in length. If each turn in an a-helix is 3.6 residues in length and each turn is 5.4 Å in length, how long is SYNZIP1? Keep in mind that 1 Å = 10 nm. Present your answer in nm.arrow_forwardThe figure shows an example of a thermal denaturation plot. The melting temperature (Tm) is the midpoint of the temperature range over which denaturation occurs. Percent unfolded 100 80 60 40 20 0 20 Tm 40 60 Temperature (°C) 80 100arrow_forwardList possible codon sequences for the following amino acids.(a) Val (b) Phe (c) Asn (d) Gly (e) Metarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license