Why “junk” DNA is a poor description of the non-coding regions of DNA in humans. Introduction: Non-coding DNA does not participate in the synthesis of any proteins.

Question

Want to see the full answer?

Answer 1

Question

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.

As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________

in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?

Answer 2

Question

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Answer 6

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Answer 7

Chapter 6, Problem 4SA

Summary Introduction

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 6 - Prob. 1SA Ch. 6 - Prob. 2SA Ch. 6 - Prob. 3SA Ch. 6 - Prob. 4SA Ch. 6 - Prob. 5SA Ch. 6 - Prob. 6SA Ch. 6 - Prob. 7SA Ch. 6 - Prob. 8SA Ch. 6 - Prob. 9SA Ch. 6 - Prob. 10SA

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans. Introduction: Non-coding DNA does not participate in the synthesis of any proteins.

Solution Summary: The author explains that "junk" DNA is a poor description of the non-coding regions of DNA in humans.

Concept explainers

Videos

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.

Want to see the full answer?

Chapter 6 Solutions

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans. Introduction: Non-coding DNA does not participate in the synthesis of any proteins.

Solution Summary: The author explains that "junk" DNA is a poor description of the non-coding regions of DNA in humans.

Concept explainers

Videos

To review: Why “junk” DNA is a poor description of the non-coding regions of DNA in humans. Introduction: Non-coding DNA does not participate in the synthesis of any proteins.

Want to see the full answer?

Chapter 6 Solutions

To review:

Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.

Introduction:

Non-coding DNA does not participate in the synthesis of any proteins.