Biology: Concepts and Investigations
4th Edition
ISBN: 9780078024207
Author: Mariëlle Hoefnagels Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 7, Problem 11WIO
The amount of melanin in the skin is controlled by genes, yet melanin is not a protein. How can this be?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Xeroderma pigmentosum is an inherited disorder characterized by rapid formation of many skin sores that develop into cancers. All forms of radiation trigger these symptoms, including fluorescent light, which contains UV light in the range of 320 to 400 nm. In most affected individuals, at least one of nine particular proteins is missing or defective. What is the collective function of these proteins?
Xeroderma pimentos is an inherited disorder characterized by rapid formation of many skin sores that develop into cancers. All forms of radiation trigger these symptoms, including fluorescent light, which contains UV light in the range of 320 to 400 nm. In most affected individuals, at least one of nine particular proteins is missing or defective. What is the collective function of these proteins?
A patient presents with the Sickle Cell Trait. How did this disease develop in the DNA and howdoes this translate to how the protein is produced in the cell?
Chapter 7 Solutions
Biology: Concepts and Investigations
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - The amount of melanin in the skin is controlled by...Ch. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Prob. 18WIOCh. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA is a nucleic acid that consists of thousands of smaller, repeating units callednucleotides. What function do nucleic acids serve besides storing geneticinformation?arrow_forwardA mutation leads to a change in one amino acid in a protein. The result is that the protein no longer functions properly. How is this possible?arrow_forwardWhy does DNA have to turn into RNA before it can make a protein? why cant DNA just make the proteins itself?arrow_forward
- Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the protein coded for by that gene? Why or why not?arrow_forwardDoes a mutation always result in a change of an amino acid sequence in protein? Why?arrow_forwardWhy is having flexible and unstructured regions of a protein important for the function of the protein?arrow_forward
- Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from tyrosine (an amino acid), a brown pigment of the hair, skin, and eyes. These individuals lack whar?arrow_forwardHow is the information in the DNA interpreted into a functional protein,such as an enzyme?arrow_forwardWhat is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. What effect might this have on the function of the protein? Why?arrow_forward
- A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.arrow_forwardWhy is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed mRNA sequence?arrow_forwardIs it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes provide an example.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license