Concept explainers
A protein-encoding region of a gene has the following DNA sequence: T T T C A T C A G G A T G C A A C A Determine how each of the following mutations alters the amino acid sequence:
a. Substitution of an A for the Tin the first posit ion
b. Substitution of a G for the C in the 17th position
c. Insertion of a T between the fourth and fifth DNA bases
d. Insertion of a GTA between the 12th and 13th DNA bases
e. Deletion of the first DNA
Want to see the full answer?
Check out a sample textbook solutionChapter 7 Solutions
Biology: Concepts and Investigations
Additional Science Textbook Solutions
Human Biology: Concepts and Current Issues
Genetics: Analysis and Principles
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Genetic Analysis: An Integrated Approach (2nd Edition)
Biology Science Notebook
- A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine basearrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardA small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine basearrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
- Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwarda molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardConsider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education