BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 6MCQ
Summary Introduction
Introduction:
A mutation can add, delete, or change nucleotides in a DNA sequence. It can also replace one base with the other. Insertion or deletion of nucleotides disrupt the reading frame and eventually changes the sequence of the encoded protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Use your genetic code (codon) table to answer the next two questions:
What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from:
AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC
A) a silent mutation
B) a nonsense mutation
C) a frame-shift mutation
D) a missense mutation
E) a base insertion mutation
a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only)
A. frameshift mutation
B. silent mutation
C. nonsense mutation
D. missense mutation
In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwarda. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequencearrow_forwardChoose the combination of answers that most accurately completes the statement. Why must the lagging strand of DNA be replicated in short pieces? a. because of limited space b. otherwise, the helix will become distorted c. the DNA polymerase can synthesize in only one direction d. to make proofreading of code easierarrow_forward
- Choose the combination of answers that most accurately completes the statement.Why must the lagging strand of DNA be replicated in short pieces? a. because of limited space b. otherwise, the helix will become distorted c. the DNA polymerase can synthesize in only one direction d. to make proofreading of code easierarrow_forwardSometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino acid sequence. Suggest several reasons why this is so.arrow_forwardSelect the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.arrow_forward
- Which type of mutation produces the same protein despite a change in the DNA? A. nonsense B. missense C. silent D. frameshiftarrow_forwardWhich statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.arrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- Which event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process mRNA in the nucleus. b. Endonuclease enzymes splice out and repair damaged DNA. c. Scientists use reverse transcriptase enzymes to make DNA from RNA. d. Codons specifying amino acids are degenerate and universal.arrow_forwardWhich type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertionarrow_forwardChoose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligamentsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY