BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 7, Problem 16WIO
Summary Introduction
To determine:
The reason for the fact that despite the amount of melanin being controlled by the genes, it is not a protein.
Introduction:
Melanin is a pigment that is present inside the living organism for the regulation of skin color. The amount of melanin in the skin is controlled by the activities of various genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Xeroderma pigmentosum is an inherited disorder characterized by rapid formation of many skin sores that develop into cancers. All forms of radiation trigger these symptoms, including fluorescent light, which contains UV light in the range of 320 to 400 nm. In most affected individuals, at least one of nine particular proteins is missing or defective. What is the collective function of these proteins?
Xeroderma pimentos is an inherited disorder characterized by rapid formation of many skin sores that develop into cancers. All forms of radiation trigger these symptoms, including fluorescent light, which contains UV light in the range of 320 to 400 nm. In most affected individuals, at least one of nine particular proteins is missing or defective. What is the collective function of these proteins?
A patient presents with the Sickle Cell Trait. How did this disease develop in the DNA and howdoes this translate to how the protein is produced in the cell?
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA is a nucleic acid that consists of thousands of smaller, repeating units callednucleotides. What function do nucleic acids serve besides storing geneticinformation?arrow_forwardA mutation leads to a change in one amino acid in a protein. The result is that the protein no longer functions properly. How is this possible?arrow_forwardWhy does DNA have to turn into RNA before it can make a protein? why cant DNA just make the proteins itself?arrow_forward
- Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the protein coded for by that gene? Why or why not?arrow_forwardDoes a mutation always result in a change of an amino acid sequence in protein? Why?arrow_forwardWhy is having flexible and unstructured regions of a protein important for the function of the protein?arrow_forward
- Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from tyrosine (an amino acid), a brown pigment of the hair, skin, and eyes. These individuals lack whar?arrow_forwardHow is the information in the DNA interpreted into a functional protein,such as an enzyme?arrow_forwardWhat is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. What effect might this have on the function of the protein? Why?arrow_forward
- A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.arrow_forwardWhy is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed mRNA sequence?arrow_forwardIs it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes provide an example.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license