Concept explainers
The DNA sequence below gives the first
Write the polarity of the two DNA strands shown.
Give the mRNA transcript sequence and the polarity of the transcript.
Assuming the sequence shown is part of a bacterial gene. Draw the approximate positions of the promoter sequence and the termination sequence.
Assuming the sequence shown is part of a bacterial gene, what consensus sequence (s) would you expect to identify in the promoter?
Write the anticipated bacterial consensus sequence(s) in the approximate position(s) on the diagram.
Assuming the sequence shown is part of a eukaryotic gene, what consensus sequence(s) would you expect to identify within about
Write the anticipated eukaryotic consensus sequence(s) in the approximate position(s) on the diagram.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 8 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value. Please keep answer between 2-3 sentencesarrow_forwardRefer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forwardUse the first picture and codon table to answer the following questions.arrow_forward
- Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA - 5' 5' - ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 2 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! #♡ 3 4 % 5 here ↓ < 6…arrow_forwardPlease please answer that full answer please What makes it possible to correctly start translation from an mRNA having multiple codons for methionine? Describe in context of eukaryotes and prokaryotes.arrow_forwardUse the gel diagram below to answer Questions 62 and 63. The positively-charged electrode of the electrophoresis gel is shown at the bottom of the diagram; the negatively-charged electrode is at the top. The mixture in each well included the original DNA fragment, all four dNTPs, one type of ddNTP as labeled in the diagram, and other necessary components of the dideoxy chain-termination reaction. The results are below. ddATP ddGTP ddCTP ddTTP (A) (B) (C) (D) (E) +. 62. Which of the following represents the sequence of the template strand?" A. 5'--GAAGACTAACATTCA--3' B. 5'-- ACTTACAATGTAGUA--3' C. 5'-- CTTCTGATTGTAAGT--3' D. 5'--ACTTACAATCAGAAG--3' E. 5'--TGAATGTTAGTCTTC--3'arrow_forward
- Complete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication Transcription translationarrow_forwardWhat is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value.arrow_forwardSelect the antisense strand of the DNA (opening at 3’ end from the left) and have it transcribed (RNA codons for translation). Translate the RNA codons using the given genetic code.arrow_forward
- The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start sitearrow_forwardWhat is the sequence in the template DNA strand during RNA production that encodes the codon GCU? Answer with 5’ and 3’ ends labeled.arrow_forwardGive typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)