GENETIC ANALYSIS: INTEGRATED - ACCESS
GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 8, Problem 30P

Genomic DNA from a mouse is isolated, fragmented, and denatured into single strands. It is then mixed with mRNA isolated from the cytoplasm of mouse cells. The image represents an electron micrograph result showing the hybridization of single-stranded DNA and mRNA.Chapter 8, Problem 30P, 8.30 Genomic DNA from a mouse is isolated, fragmented, and denatured into single strands. It is then

Which nucleic acid is indicated by the "a" pointer? Justify your answer.

Which nucleic acid is indicated by the "b" pointer? Justify your answer.

What term best identifies the nucleic acid region indicated by the "c" pointer?

What term best identifies the nucleic acid region indicated by the "dā€ pointer?

Based on this electron micrograph image, how many introns and exons are present in the mouse DNA fragment shown?

Blurred answer
Students have asked these similar questions
Total nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with specialized beads to which the single-stranded DNA molecule with sequence 5ā€™-TTTTTTTTTTTTTTTTTTTTTTTTT-3ā€™ has been covalently attached to the surface (see image to the right, where each black line represents a polynucleotide sequence). After a short incubation time, the beads are removed from the mixture. When you analyze the cellular nucleic acids stuck to the beads, which type of nucleic acid (i.e. DNA, rRNA, etc.) do you expect to be the most abundant? Why?
As you should recall, DNA, when not being actively transcribed, has a double helical structure.Ā  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.Ā  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Ā Ā  Q:Ā  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the templateĀ  Ā strand?Ā  ______________________________ Q:Ā  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:Ā  Ā  Ā  ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:Ā  ________--________--________--________--________--________--________--________
Below is the 5ā€™ā€“3ā€™ strand of a double-stranded DNA molecule with the following nucleotide sequences:5ā€™ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3ā€™1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?

Chapter 8 Solutions

GENETIC ANALYSIS: INTEGRATED - ACCESS

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License