Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 2P
In one to two sentences each, describe the three processes that commonly modify eukaryotic
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
List the steps in the processing of a typical eukaryotic mRNA precursor to prepare it for its functional role.
Name and describe three types of modification that the mRNA undergoes in eukaryotes before the
MRNA is translated.
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - 13. How do SR proteins help guide premRNA intron...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forwarda) Two of the following three mRNA sequences code for the same protein. Delete the sequence which does NOT code for the same protein as the other two. [ /1] #1 UUU CCU AGU GGU #2 UUC CCA AGC GGC #3 UUC CCG AGA GGA b) Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Based on what you have learned in this unit, explain how this might happen.arrow_forwardIf there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?arrow_forward
- List several ways in which eukaryotic messenger RNA differs from prokaryotic mRNA.arrow_forwardGenes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given genearrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAarrow_forward
- List and draw out four distinctive features of most eukaryotic mRNAs.arrow_forwardEukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this accomplished in eukaryotes? What processes tend to degrade mRNA molecules in both eukaryotes and prokaryotes, and why are these processes needed?arrow_forwardb) In eukaryotes, the newly synthesized MRNA undergoes modifications before it is transported across the nuclear membrane into the cytoplasm. Outline any two of the three modifications.arrow_forward
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCAarrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY