Concept explainers
To analyze:
The complete sequence of a gene is present in a
Lane
Lane
Lane
Lane
a. Sketch the relative positions expected for the DNA fragments in this gel electrophoresis analysis.
b. Identify the relative positions of bands in lane
c. The relative positions of bands in lanes
Introduction:
Band shift assay is a technique to study the interactions between protein and DNA. The assay is based on non-denaturing gel electrophoresis that runs complexes of proteins and DNA through it. The migration of either DNA or RNA is compared to the migration of a complex of particular protein with DNA or RNA. This study helps to reveal the degree and nature of binding between them. It is also termed as electrophoretic mobility shift assay. The Band shift assay is the separation technique for proteins, DNA and RNA, the mixture of interest is loaded onto an agarose gel and observed for speed, size, and shape.
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
- You are attempting to prepare a single gene knockout library using the pRL27 transposon system. You grow the donor E. coli in Luria broth containing both kanamycin and diaminopimelic acid (DAP) and your recipient Serratia rubidaea in plain Luria broth. You combine an equal ratio of donor and recipient cultures and plate the mixture onto Luria agar supplemented with DAP. After 24 hours incubation at 37°C, you create a cell slurry and plate the cells onto Luria agar aupplemented with kanamycin. After 24 hours incubation at 37°C, you find that no colonies grow. What best explains this outcome? A. Failure to supplement media with DAP B. Failure to remove antiobiotic containing media C. Failure to incubate for a sufficient length of time D. Failure to incubate at the appropiate temperature E. Failure to use the proper mating mix ratioarrow_forwardThe following is a section of the gene coding for bovine rhodopsin along with several restriction endonucleases, their recognition sequences, and their hydrolysis sites. Which endonucleases will catalyze cleavage of this section of DNA? 5-GCCGTCTACAАСССGGTCATCTAАСТАТСАТGATCААСАAGCAGTTCCGGAACT-3' Recognition Sequence Recognition Sequence Enzyme Enzyme AG | CT TGG | CCA CG I CG GG | CC CI CGG | GATC GC | GGCCGC GAGCT | C Alul Hpall Ball Mbol FnuDII NotI HealII Sadarrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forward
- How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript? answer in numerical digits only.arrow_forwardAfter cloning is carried out to insert a foreign gene into BL21(DE3), you would like to confirm the expression of the foreign protein in the bacteria using a blotting technique. Briefly describe the steps to achieve your objective with simple illustrations and descriptions.arrow_forwardTo identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forward
- After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…arrow_forwardCre-Lox system is used for site-specific modification of DNA for genetic engineering applications. The reporter gene construct shown below is used to test the Cre-Lox system. Cells are transfected with the construct shown below and the activity of the constructs is determined by visualizing the cells with a fluorescence microscope. Match the following conditions with the expected cell observations. Hint: Make sure you note the position of the Start and Stop. The GFP and RFP genes shown do not have start codons. Cre/Lox Reporter Gene ATG LoxP CMV-Pro A. No Expression GFP Stop B. GFP Only LoxP Absence of Cre Cells treated with drug that induces expression of Cre RFP C. RFP Only A. Image A B. Image B C. Image C D Image D express ? D. RFP and GFParrow_forwardBacteria can be used to produce human growth hormone (HGH - a peptide/protein) through genetic engineering. The human gene for HGH is inserted into a plasmid, which is then taken up by a bacterial cell, which divides and multiplies into a clone of cells, all of which contain the plasmid with the HGH gene. The bacteria express the HGH gene, producing HGH which can be harvested and used for treatment of humans. (See figure below) Which of the following statements is NOT true about this process? bacterium Vector, such as a DNA containing the gene of plasmid, isolated it from a different species is Gene encoding protein for pest resistance is inserted into plant cells ©2019 Pearson Education, Inc chromosome recombinant DNA (plasmid) transformed bacterium Create and harvest copies of a gene with either of two goals in mind. Gene encoding degradative enzyme to clean up toxdo waste is inserted into bacterial cells ved by an enzyme into gene of interest The desired gene is selected and…arrow_forward
- The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…arrow_forwardBriefly explain how synthetic probes are created to screen a DNA library when the protein encoded by the gene is known.arrow_forwardA new technique for rapidly determining the nuclesome structure for regions of chromatin is called Mnase-Seq. Briefly, in MNase-Seq experiments, the chromatin is digested with Micrococcal Nuclease (MNase) and then the resulting digest is subjecting to high throughput sequencing to identify sequences digested by enzyme. See this short article for complete explanation. In the experiment below, researchers conducted an Mnase Seq experiment on a region of a chromosome in the absence (OHT-) and presence (OHT+) of a Protein X. This protein has a dramatic effect on the expression of the Igll1 gene, but no effect on Top3b nor Vpreb1 genes. Based on this information, explain what Protein X is doing to influence the Igll1 gene (limit 4-5 sentences).arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning