Microbiology with Diseases by Taxonomy (5th Edition)
5th Edition
ISBN: 9780134019192
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 5CT
Summary Introduction
To describe:
The fragments obtained by digesting the enzyme
Introduction:
Restriction digestion takes place at specific sites in the genome. It depends upon the type of restriction enzymes used for digesting the palindromic repeat sequences in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence.
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
true or false: DNA ligase seals nicks between DNA fragments by forming a new phosphate bond.
Chapter 8 Solutions
Microbiology with Diseases by Taxonomy (5th Edition)
Ch. 8 - Which of the following statements is true...Ch. 8 - A DNA gene synthesized from an RNA template is...Ch. 8 - Prob. 3MCCh. 8 - Prob. 4MCCh. 8 - Prob. 5MCCh. 8 - Which of the following would be most useful in...Ch. 8 - Prob. 7MCCh. 8 - Prob. 8MCCh. 8 - Prob. 9MCCh. 8 - Prob. 10MC
Ch. 8 - Prob. 1TFCh. 8 - Prob. 2TFCh. 8 - Prob. 3TFCh. 8 - ________ Protoplast fusion is often used in the...Ch. 8 - Prob. 5TFCh. 8 - Label the reagents and steps of PCR on the figure...Ch. 8 - Describe three artificial methods of introducing...Ch. 8 - Prob. 2SACh. 8 - Prob. 3SACh. 8 - Prob. 4SACh. 8 - List three potential problems of recombinant DNA...Ch. 8 - Examine the restriction sites listed in Table 8.1...Ch. 8 - Prob. 2CTCh. 8 - A thermocycler uses DNA polymerase from...Ch. 8 - How is the result of a Southern blot similar to...Ch. 8 - Prob. 5CTCh. 8 - Prob. 6CTCh. 8 - If a gene contains the sequence TACMTCGCATTGM,...Ch. 8 - Prob. 8CTCh. 8 - Prob. 9CTCh. 8 - Using the following terms, fill in the following...Ch. 8 - Why arent the terms recombinant DNA technology...Ch. 8 - Why did the discovery and development of...Ch. 8 - Why wasnt polymerase chain reaction (PCR)...Ch. 8 - Why dont doctors routinely insert genes into their...Ch. 8 - Why dont scientists who work with recombinant DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Enzymes isolated from bacteria that cut DNA at specificsequences are called ____________________.arrow_forwardIs there any situation in which DNA is made based on a RNA template? What is the enzyme involved?arrow_forwardA DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAGarrow_forward
- The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products expected in each reaction. Indicate the activity used in each reaction.arrow_forwardA microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this enzyme, fragments that average 1,048,500 bp in length are produced. What is the most likely number of base pairs in the recognition sequence of this enzyme?arrow_forwardWithin the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC. Following replication of the DNA, what change in the polypeptide product would this cause?arrow_forward
- Define and indicate the significance of DNA ligasearrow_forwardWhen circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?arrow_forwardThe enzymes DNA polymerase in E.coli is a DNA dependent polymerace and also has the ability to proof-read the DNA strand being synthesised?arrow_forward
- Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or function isbeing affected by each mutation. Supercoiled strands remain after replication, which is never completed.arrow_forwardName the enzymes that cut the DNA at specific sequences and create sticky ends.arrow_forwardIdentify the dinucleotide CA repeat region and the score in the following sequence:TGGCACACTCACACCACACAGACAGTTAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license