Connect 1-semester Access Card For Genetics
5th Edition
ISBN: 9780077515041
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr., Charles (chip) Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, there are some genes that are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
| a. | Asn at position 10 in protein A is changed to Tyr. |
| b. | Leu at position 12 in protein A is changed to Pro. |
| c. | Gln at position 8 in protein B is changed to Leu. |
| d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following diagram describes the mRNA sequenceof part of the A gene and the beginning of the B geneof phage ϕX174. In this phage, some genes are read inoverlapping reading frames. For example, the code forthe A gene is used for part of the B gene, but the readingframe is displaced by one base. Shown here is the singlemRNA with the codons for proteins A and B indicated.aa# 5 6 7 8 9 10 11 12 13 14 15 16A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeumRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUGB MetGluGlnLeuThrLysAsnGlnAlaaa# 1 2 3 4 5 6 7 8 9Given the following amino acid (aa) changes, indicatethe base change that occurred in the mRNA and theconsequences for the other protein sequence.a. Asn at position 10 in protein A is changed to Tyr.b. Leu at position 12 in protein A is changed to Pro.c. Gln at position 8 in protein B is changed to Leu.d. The occurrence of overlapping reading frames isvery rare in nature. When it does occur, the extentof the overlap is…
Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein.
Transeriptional terminator
Promoter
Intron 1
Intron 2
1 100
s100 base pairs
1100
2100
3100
4100
Positions 200-203 = Start codon
Positions 4800-4802 = Stop codon
Figure 2.
(i)
The transcript first produced by ABC gene would be approximately how many
nucleotides long?
Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome.
a) Indicate where on the diagram you would find the following for each gene:
Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3)
Transcription termination site (tts1, tts2, and tts3)
Start codon (start1, start2, and start3)
Stop codon (stop1, stop2, and stop3)
Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis
Be sure to indicate the component on the appropriate molecule (DNA or RNA).
Chapter 8 Solutions
Connect 1-semester Access Card For Genetics
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 on p. 260 may have...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - Prob. 13PCh. 8 - How many possible open reading frames frames...Ch. 8 - a. In Fig. 8.3 on p. 257, the physical map the...Ch. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - a. The genetic code table shown in Fig. 8.2 on p....Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Concerning the list of eukaryotic gene elements in...Ch. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - Prob. 42PCh. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - There is at least one nonsense suppressing tRNA is...Ch. 8 - Prob. 47PCh. 8 - Brenners m mutant phages m1 m6 described in Fig....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardThe RNA transcript of a region of T4 phage DNA contains the sequence 5’-AAAUGAGGA-3'. This sequence encodes three different polypeptides. What are they?arrow_forwardThe diagram, shown in attatched image, shows an mRNA that is alternatively spliced. The alternatively spliced variant contains Exon 1, Exon 2, and Exon 4. Indicate below if a splice site is used, blocked by a modifying protein such that the spliceosome must choose a different site, or skipped to make this alternatively spliced variant.arrow_forward
- Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1arrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. = exons Transcription termination site (also poly A site) = introns Promoter Start of transcription 3' 5'. TAA ATG 50 TAC 130 222 850 126 132 90 ATT 5' 3 QUESTION 3: What is the length in nucleotides of the mature, processed B-globin mRNA? A.620 B.980 C.438 D.1600arrow_forwardIn the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the DNA sequence of Gene c on the non-template strand. 4. Genes a and c are transcribed from the bot strand,... RNA DNA 5' 3 Gene a GGACCTA Gene b Gene c 3' 5' ACGTCAG RNA RNA UUAGAUC ...and b is transcribed from the top strand.arrow_forward
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardThe following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forward
- Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. Question 6: How many amino acids are present in the wild-type human B-globin protein? = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5' ATG 50 TẠC TAA 126 132 |ATT 90 130 222 850 3 5' Start codon Stop codon А. 438 В. 146 C. 620 D. 206 © 2013 John Wiley & Sons, Inc. All rights reserved.arrow_forwardHelp me pleasearrow_forwardThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY