Concept explainers
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations.
- a. met-trp-
- b. met-cys-ile-val-val-leu-gln-
- c. met-trp-tyr-arg-ser-pro-thr-
- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
a.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codons allow the mRNA to transcribe the DNA template while stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The first mutation occurred and formed “met-trp” protein. Possibly, the mutation occurred at ‘tyr’, which resulted in the termination. The termination is caused by a stop codon. The possible triplet codons after mutation in “met-trp” are :
Met | Trp | Stop codons |
AUG | UGG | UAA |
UAG |
In the original sequence, tyrosine is present. However in mutated sequences, stop codons are formed, which shorten the polypeptide to Trp.
b.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-cys-ile-val-val-leu-gln”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-cys-ile-val-val-leu-gln” protein. Possibly the point mutation occurred which caused changes in the reading frame. The triplet codons of the mutated protein “met-cys-ile-val-val-leu-gln” are :
Met | Cys | Ile | Val | Val | Leu | Gln |
AUG | UGU | AUA | GUG | GUC | CUA | ACU |
GUG | ACC | |||||
ACA | ||||||
ACG |
The highlighted codons are mutated. The single place deletion or insertion may arise this type of situation where the complete sequence is changed.
c.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-ser-pro-thr”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The third mutation occurred and formed “met-trp-tyr-arg-ser-pro-thr” protein. Possibly the frameshift mutation occurred, which caused changes in the reading frame. The triplet codons of the mutated protein “met-trp-tyr-arg-ser-pro-thr” are :
Met | Trp | Tyr | Arg | Ser | Pro | Thr |
AUG | UGG | UAU | AGA | AGU | CCU | ACU |
UAC | AGG | CCC | ACC | |||
CCA | ACA | |||||
CCG | ACG |
Here, the only codon for glycine is completely changed. The single frame is inserted and deleted from the same place.
d.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-” this protein. This is a type of mutation where the reading frame is shifted because this protein is relatively larger than the normal protein.
Hence, frame insertion is a possible way due to which the protein is completely changed.
Want to see more full solutions like this?
Chapter 9 Solutions
HUMAN HEREDITY-MINDTAP (1 TERM)
- When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4 translation, however, is increased. A. Why? B. In general, what is the mechanism by which Gcn4 levels are increased? C. What would happen under high and low amino acid conditions if only one of the upstream ORFs were deleted from Gcn4? D. What would happen under high and low amino acid conditions if all of the upstream ORFs were deleted from Gcn4?arrow_forwardWhat would be the effect of a mutation that causes a poly(A)-binding protein to be nonfunctional?arrow_forwardA. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forward
- A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine basearrow_forwardGeneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?arrow_forwardSuppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Learrow_forward
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardWhich of the following are elongation factors involved in the release of free tRNAs? a.EF-G b.EF-Ts c.EF-Tu d.EF-Parrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning