Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 3NST
DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules are required for translation of proteins within mitochondria. Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA? Explain why
Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What might be a rationale for this limitation?
Chapter 9 Solutions
Concepts of Genetics (12th Edition)
Ch. 9 - Chlamydomonas, a eukaryoric green alga, may be...Ch. 9 - In aerobically cultured yeast, a petite mutant is...Ch. 9 - DNA in human mitochondria encodes 22 different...Ch. 9 - Prob. 4NSTCh. 9 - Why did Marcia choose mitochondrial testing to...Ch. 9 - Marcia saw an ad on television for ancestry DNA...Ch. 9 - How much importance should we place on the results...Ch. 9 - HOW DO WE KNOW? In this chapter, we focused on...Ch. 9 - Review the Chapter Concepts list on page 196. The...Ch. 9 - Streptomycin resistance in Chlamydomonas may...
Ch. 9 - A plant may have green, white, or green-and-white...Ch. 9 - In diploid yeast strains, sporulation and...Ch. 9 - Predict the results of a cross between ascospores...Ch. 9 - In Lymnaea, what results would you expect in a...Ch. 9 - In a cross of Lymnaea, the snail contributing the...Ch. 9 - In Drosophila subobscura, the presence of a...Ch. 9 - A male mouse from a true-breeding strain of...Ch. 9 - Consider the case where a mutation occurs that...Ch. 9 - What is the endosymbiotic theory, and why is this...Ch. 9 - In an earlier Problems and Discussion section (see...Ch. 9 - Mitochondrial replacement therapy (MRT) offers a...Ch. 9 - The specification of the anteriorposterior axis in...Ch. 9 - The maternal-effect mutation bicoid (bcd) is...Ch. 9 - (a) In humans the mitochondrial genome encodes a...Ch. 9 - Mutations in mitochondrial DNA appear to be...Ch. 9 - Researchers examined a family with an interesting...Ch. 9 - Payne, B. A. et al. (2013) present evidence that a...Ch. 9 - As mentioned in Section 9.3, mtDNA accumulates...Ch. 9 - Because offspring inherit the mitochondrial genome...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serinearrow_forwardThe oxidation of guanine bases in the context of triplet repeats such as CAGCAGCAG can lead to the expansion of the repeat. Explain.arrow_forwardThe covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it requires an input of energy for the reaction to proceed. Where does the energy come from to attach amino acids to tRNA molecules?arrow_forward
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forwardThe E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardThe protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?arrow_forward
- The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G', whereas a 'C' in the wobble position of the anticodon can only pair with 'G'. what is the anticodon found on the Methionine tRNA?arrow_forwardFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?arrow_forwardThe following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried by each of these tRNAs. a. 5′ –UUU–3′ b. 5′ –GAC–3′ c. 5′ –UUG–3′ d. 5′ –CAG–3′arrow_forward
- Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or lysine, how does it work ?arrow_forwardWhy do bacteria use formylated methionine in the initiator tRNA, while eukaryotes do not?arrow_forwardFor the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY