Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 3P
The calculations of the average restriction fragment size in Fig. 9.2 assume that DNA is composed equally of the four possible
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and finally, by both EcoRI and SmaI together. The following results are obtained:
Draw a map of the EcoRI and SmaI restriction sites on this 14-kb piece of DNA, indicating the relative positions of the restriction sites and the distances between them.
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below.
5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region
3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region
After several tries, you obtained a beautiful sequencing image as shown here:
The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline:
Tm is 55 – 60°C.
Ensures primer had a appropriate melting temperature for PCR ans sequencing.
The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%).
A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA.
The secondary structure of the primer must be none or weak.
No primer dimers (The primer anneals to itself).
3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC
This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Chapter 9 Solutions
Genetics: From Genes to Genomes
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forwardAssume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?arrow_forwardA 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bparrow_forward
- What are the consequences for a DNA sequencing reaction if the ratio of dideoxyribonucleoside triphosphates to deoxyribonucleoside triphosphates is increased? What happens if this ratio is decreased?arrow_forwardAlthough DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?arrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forward
- Knowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?arrow_forwardDNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.arrow_forwardWhat is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.arrow_forward
- When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?arrow_forwardThe region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a restriction site such that homozygous normal individuals show two DNA fragments. If a single nucleotide change in hemoglobin destroys that restriction site, then how many DNA fragments will be visible on a gel from individuals that are homozygous mutant? What about heterozygotes?arrow_forwardEven in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License