Biochemistry
8th Edition
ISBN: 9781285429106
Author: Campbell, Mary K., FARRELL, Shawn O.
Publisher: Cengage Learning,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 52RE
Interpretation Introduction
Interpretation:
The reason behind 50S ribosomal subunit and a 30S ribosomal subunit combine to form 70S subunit, instead of an 80S subunit is to be interpretated.
Concept Introduction:
Ribosomes and ribosomal RNA subunits has been studied on the basis of sedimentation coefficients. S is the Svedberg's unit. The sedimentation rate for a particle of a given size and shape measures how fast the particle 'settles'. The S value increase with the molecular weight of the sedimenting particle, but it is not directly proportional to it because the particle’s shape also affects its sedimentation rate.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine.
5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Why would 60S and 40S ribosomal subunits make an 80S ribosome rather than a 100S ribosome?
Chapter 9 Solutions
Biochemistry
Ch. 9 - REFLECT AND APPLY Consider the following in light...Ch. 9 - Prob. 2RECh. 9 - RECALL What is the structural difference between...Ch. 9 - RECALL Give the name of the base, the...Ch. 9 - RECALL What is the difference between ATP and...Ch. 9 - RECALL Give the sequence on the opposite strand...Ch. 9 - RECALL Are the sequences shown in Question 6 those...Ch. 9 - REFLECT AND APPLY (a) Is it biologically...Ch. 9 - REFLECT AND APPLY A friend tells you that only...Ch. 9 - REFLECT AND APPLY In the early days of molecular...
Ch. 9 - REFLECT AND APPLY Why is RNA more vulnerable to...Ch. 9 - Prob. 12RECh. 9 - RECALL Draw a GC base pair. Draw an AT base pair.Ch. 9 - RECALL Which of the following statements is (are)...Ch. 9 - Prob. 15RECh. 9 - BIOCHEMICAL CONNECTIONS Describe the landmark case...Ch. 9 - Prob. 17RECh. 9 - Prob. 18RECh. 9 - RECALL Which of the following statements is (are)...Ch. 9 - RECALL Define supercoiling, positive supercoil,...Ch. 9 - RECALL What is propeller twist?Ch. 9 - RECALL What is an AG/CT step?Ch. 9 - RECALL Why does propeller-twist occur?Ch. 9 - Prob. 24RECh. 9 - RECALL If circular B-DNA is positively...Ch. 9 - RECALL Briefly describe the structure of...Ch. 9 - Prob. 27RECh. 9 - REFLECT AND APPLY List three mechanisms that relax...Ch. 9 - REFLECT AND APPLY Explain how DNA gyrase works.Ch. 9 - Prob. 30RECh. 9 - REFLECT AND APPLY Would you expect to find...Ch. 9 - REFLECT AND APPLY One of the original structures...Ch. 9 - REFLECT AND APPLY What is the complete base...Ch. 9 - REFLECT AND APPLY Why was it necessary to specify...Ch. 9 - Prob. 35RECh. 9 - Prob. 36RECh. 9 - Prob. 37RECh. 9 - BIOCHEMICAL CONNECTIONS A recent commercial for a...Ch. 9 - REFLECT AND APPLY A technology called PCR is used...Ch. 9 - REFLECT AND APPLY Why does DNA with a high AT...Ch. 9 - Prob. 41RECh. 9 - Prob. 42RECh. 9 - Prob. 43RECh. 9 - Prob. 44RECh. 9 - 45. Why does the absorbance increase when a DNA...Ch. 9 - Prob. 46RECh. 9 - REFLECT AND APPLY Would you expect tRNA or mRNA to...Ch. 9 - REFLECT AND APPLY The structures of tRNAs contain...Ch. 9 - REFLECT AND APPLY Would you expect mRNA or rRNA to...Ch. 9 - REFLECT AND APPLY Which would be more harmful to a...Ch. 9 - Explain briefly what happens to eukaryotic mRNA...Ch. 9 - Prob. 52RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.arrow_forwardFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?arrow_forwardExplain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or lysine, how does it work ?arrow_forward
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusarrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forwardThree E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?arrow_forward
- For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?arrow_forwardThe infectious prion protein which are believed to cause a neurodegenerative disease by acting as a template to misfold other cellular prion proteins are usually β-helices. Is this correct or not?arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license