Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 8SQ
Summary Introduction
Introduction: Transcription is the process in which the
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Once translated into proteins:
(a) How many nucleotides are there?
(b) How many codons are there?
(c) How many amino acids?
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - An RNA molecule is typically ______; a DNA...Ch. 9 - RNAs form by_____; proteins form by ________. a....Ch. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....Ch. 9 - Prob. 7SQCh. 9 - Prob. 1DAACh. 9 - Prob. 2DAACh. 9 - Prob. 3DAA
Ch. 9 - Prob. 4DAACh. 9 - Prob. 8SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Up to ______ amino adds can be encoded by an mRNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. __...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardAddition or deletion of bases causes which kind of mutation? Select one: a. Frameshift mutation b. Transversion c. Transition d. Transcriptionarrow_forwardTranscription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardProcess by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterificationarrow_forwardTranscription factors a. help the RNA polymerase bind DNA b. are involved in chromatin remodeling, uncoil the DNA c. modulate transcription from the distance d. add the 5’ CAP to the RNAarrow_forward
- The function of the genetic code is toa. promote transcription.b. specify the amino acids within a polypeptide.c. alter the sequence of DNA.d. do none of the above.arrow_forwardDuring transcription the strands of DNA unwind due to the action of (a) DNA Helicase (b) SSBP (c) DNA polymerase III (d) ribosome (e) RNA polymerasearrow_forwardA mutation takes place that switches a codon from ACG to ACA. What type of mutation is this? A) nonconservative missense B) silent C)nonsense D) Conservative missensearrow_forward
- Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'arrow_forwardCG Islands in DNA are important for :- A) Methylation B) Acetylation C) t- RNA synthesis D) DNA replicationarrow_forwardAfter transcription, the molecule that is formed is a.complementary to part of one strand of DNA. b.complementary to both strands of DNA. c.double-stranded and inside the nucleus. d.identical to an entire single strand of DNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY