Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
9th Edition
ISBN: 9780134319070
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter CHST2, Problem 6DQ
How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein that it encodes is only found in a few specific regions of the cytoplasm? Cite a few different possibilities.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein that it encodes is only found in a few specific regions of the cytoplasm? Cite a few different possibilities.
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene?
Â
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this
 Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA.Â
Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
Chapter CHST2 Solutions
Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
Ch. CHST2 - What are some of the different roles that RNA...Ch. CHST2 -
2. What arguments support the RNA World...Ch. CHST2 - Prob. 3RQCh. CHST2 - How is bacterial DNA methylation and expression of...Ch. CHST2 - What are the three types of small noncoding RNAs...Ch. CHST2 - The mechanism for RNA-induced transcriptional...Ch. CHST2 - Although exRNAs are found in many fluids within...Ch. CHST2 - How and why are eukaryotic mRNAs transported and...Ch. CHST2 - The RNA World Hypothesis suggests that the...Ch. CHST2 - Bacterial sRNAs can bind to mRNAs through...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the three modifications made to pre-mRNA molecules before they become mature mRNAs, are transported from the nucleus to the cytoplasm, and become ready to be used in protein synthesis? What is the function of each modification?arrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. Â ATAAGCCAGACTCAGCAarrow_forwardWhat amino acid sequence is coded by the following mRNA base sequence?arrow_forward
- How many amino acid are in each of the two polypeptides produced? And how many nucleotides long would the final processed mRNA made from the gene be?arrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.  ATGATAGCCAGACTCGCAarrow_forwardAs shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?arrow_forward
- Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?arrow_forwardDraw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.arrow_forwardGiven the following mRNA sequence, what is the amino acid sequence of the polypeptide that will be produced in the cell?  5’ – CGAGGUAUGCCAACGUGCGUCUAAUCCCGA-3arrow_forward
- Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain.arrow_forwardThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’arrow_forward"The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic?  mRNA Option 1: [Exon 1a][Exon 2][Exon 3]....  mRNA Option 2:[Exon1b][Exon2][Exon 3]  mRNA Option 3: [Exon1c][Exon2][Exon 3]arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license