Library assignment

What are "genetic biohackers" in reference to "do it yourself CRISPR kits"? Who is Josiah Zayner and what is he infamous for?  Feel free to search that online...

How will you know if the bacterial cells were transformed during the lab? notes are attached below

What is the final volume of the individual PCR reactions we are making?

What is DNA fingerprinting? Mention its applications? Help me

Can someone help me with this worksheet please? See the image attached. Directions: The people below are posting their ideas about how the offspring of organisms—plants, animals, and even humans—may or may not resemble their parents. For each statement, circle the “thumbs-up” or “thumbs-down” to indicate whether or not you agree with their idea; then write a comment in the space provided.

Why is gene editing becoming a trend in modern genetic engineering? Provide a concrete example on your explanation.   2. Out of 4 presented methodologies in gene modification/editing, which do you think is the most promising in providing efficient result? Why do you say so?     3. What makes the species of Agrobacterium ideal for genetic engineering? Describe its characteristics and its role in producing transgenic plants.     4. In which of the following aspects do you think it is worthwhile to develop genetic engineering? Why or why not?       a.) Agriculture and Food Industry       b.) Medicine       c.)Research       d.) Entertainment       5.  What are the possible bioethical issues that gene editing tools may encounter?     6. Do you think genetic engineers play God when they modify the genes of various organisms to enhance their existing traits? Why or why not?

What's the main difference between first-generation sequencing, second-generation sequencing and whole genome amplification.

Select all that would be true if I had a missense mutation in an gene: The missense mutant protein would be the same size by Western as the wildtype protein The missense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The missense mutant protein would be a different size by Western compared to the wildtype protein The missense mutant allele would be the same size as wildtype by PCR-electrophoresis

please solve this with step-by-step calculations and explanations.

Based on the images attached, what does the similarity in the sequences tell you about the ermB gene found in these bacteria? Would we expect high or low sequence similarity when considering the possibility of horizontal gene transfer?

What are the components require in a PCR reaction?  And justify them?  Please answer at your own words.

● Gene lacZ fliE Please fill in the table below for the desired mutations from section five. Please reword any pathway information you find and reference the source (not just ecocyc.com) omp A lexA Size of gene (bp) 3075 315 rpoA nagC 1221 990 1041 609 Protein Pathway Expected size of PCR (bp) name

I only need help with question #8. Use question #7 as context for question #8.

1. What is the difference between an iterated blast (psi-blast) search and a simple blastsearch?2. Arslan sequenced a gene in lab how he will know about the gene either it is noveldiscovery or gene is already present in the database?3. Ruwaifa want to compares a nucleotide query sequence what option he will opt inBLAST and why?4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected

Which of the following are common types of datalanalysis that are used in bioinformatics. O DNA sequencing O RNA sequencing Epigenomic O Proteomic QUESTION 6 Order the following processes into the correct order for the generation and analysis of sequence data v Quality control analysis v Prepare sequencing libraries v Extraction of genetic material v Sequence and generate sequence data Alignment and/or variant calling Collection of cells for analysis

Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?

1. Definitions and brief statements 1. DNA Data Bank of Japan 2. MeSH Database 3. Please describe the 3 steps and temperature that are cycled during a PCR reaction. 4. What are global alignment and local alignment and their algorithms? ( 5. ProtScale

Please answer fast Find a genetically modified organism of interest. What organism is the origin of the coding sequence? What is the product of this recombinant gene? What is the commercial interest in this GMO? What are the ethical concerns with GMOs?

what is the |usage of DNA separation in gel electrophoresis please write the resources under the answer

Please solve accurate and exact. Thanks

The College of Medicine of the University of the USA - Texas offers a double degree program on medicine and molecular biology. Once you complete the requirements of the said program, you will graduate as a Medical Doctor and a Doctor Philosophy in molecular medicine (MD- PhD).  Once of the requirements of the said program is to publish a dissertion on molecular medicine. Suppose you are on your final year under the said program, you will discuss one biomelecular disorder. You will then propose possible ways on addressing the said disorder.

Question one: PCR You want to amplify the underlined sequence, 1) Design Forward and Reverse primers to do so 2) Calculate the melting temperature for them 3) Calculate annealing temperature for them 4) Do you think your primers are high quality (Length, differences in melting between R and F, possibility of forming hairpins)? GTGTGCTGGTTATTCAAACAGATAAAAAAATTAAT CTATATGGTAATGCTCTAAGCCGCGCAAATACAG AATATGTGCCAGCCTCTACATTTAAAATGTTGAAT GCCCTGATCGGATTGGAGAACCAGAAAACGGATA TTAATGAAATATTTAAATGGAAGGGCGAGAAAAG GTCATTTACCGCTTGGGAAAAAGACATGAСАСТА GGAGAAGCCATGAAGCTTTCTGCAGTOCCCAGTCT ATCAGGAACTTGCGCGACGTATCGGTCTTGATCT CATGCAAAAAGAAGTAAAACGTATTGGTTTCGGTA ATGCTGAAATTGGACAGCAGGTTGATAATTTCTG GTTGGTAGGACCATTAAAGGTTACGCCTATTCAA GAGGTAGAGTTTGTTTCCCAATTAGCACATACACA GCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAA AAAATATGCTTCTTTTAGAAGAGAGTAATGGCTAC AAAATTTTTGGAAAGACTGGTTGGGCAATGGATAT AAAACCACAAGTGGGCTGGTTGACCGGCTGGGTT GAG

Describe PCR. Give a real world example of when PCR may be used in the lab to solve a problem. Do a little research if nothing comes into your mind. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). B I US Paragraph Arial x² X₂ ¶ Ⓡ ||| ||| 冈 A v 880 V Ix % $1 田田田由用

2.. Describe how mutations are linked to DNA polymorphism. GUIDELINES: Each answer should be 250 words in length. Content should not be copied. References and bibliography should be provided for the content and images.   asap please

please solve this with step-by-step calculations and explanations.

I just need the answer

What is the fastest method to determine if a genetic disorder is due to a mutation at a palindromic site? Sequencing of the DNA by Sanger Northern blotting Southern blotting RFLP analysis in agarose gel electrophoresis PCR

If possible please answer all questions based on the gel electrophoresis:  1. What is PCR product size?2. Which reactions were successful/unsuccessful? Which reactions showed clean products? (J1...J6 = jump lines), (N= negative control) & (P= positive control)

You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.

TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?

From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”?      B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment?     C- Mention the name and the color of the dyes used in expression microarray?      D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?

O e. Gene amplification CLEAR MY CHOICE To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? Oa. Western blotting O b. Gene knockdown O. PCR/OLA O d. Microscopy O e. DNA hybridization Paternity testing can be detected most precisely by using technique

BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21 ick Save and Submit to save and submit. Cick Save All Answers to save all answers.

What is sustainability for you? Give 4 examples to differentiate between sustainable vs. un-sustainable products in biotechnology.