1 Corals are animals that live on the sea bed. The photograph shows some species of coral. (a) Corals can reproduce sexually, releasing sperm cells into the water. The mass of DNA in one sperm cell from a species of coral is 0.5 picogram. (i) Suggest the mass of DNA that would be present in an unfertilised egg cell of the same species. (1)

1 Corals are animals that live on the sea bed. The photograph shows some species of coral. (a) Corals can reproduce sexually, releasing sperm cells into the water. The mass of DNA in one sperm cell from a species of coral is 0.5 picogram. (i) Suggest the mass of DNA that would be present in an unfertilised egg cell of the same species. (1)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 5QP: How many nucleotides does the human genome contain?

See similar textbooks

Similar questions

The average human chromosome contains about 1 x 108 bp of DNA.(a) If each base pair has a mass of about 660 daltons and there are about 2 g of protein (histones plus nonhistones) per gram of DNA, how much doessuch a chromosome weigh (in grams)?(b) If the DNA were extended, how long would it be?(c) An actual chromosome is about 5 mm long. What is the approximatecompaction ratio?(d) You have about 4 x 1012 cells in your body. If you have 46 chromosomes in each cell, what is the approximate extended length of all of your DNA? For comparison, the distance from the earth to the sun isabout 1.5 x 108 km.
1. a) What does DNA stand for? b)What is the name of the DNA structure?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Each cell of the human body contains 46 chromosomes. How many DNA molecules does this statement represent? How many different types of DNA molecules does it represent?
Suppose a piece of DNA is cut into four fragments of varying sizes. Where would you expect to find the larger fragments on the gel (top, middle, or bottom)? Why? Suppose you had 1000 pieces of each of the four fragments, how many bands would appear on the gel?
If the DNA of one human cell is stretched out, it would be almost 6 feet long and contain over three billion base pairs. How does all this fit into the nucleus of one cell?
A medium-sized human chromosome contains about 100 millionbp. If the DNA were stretched out in a linear manner, how longwould it be?
If a human nucleus is 10 mm in diameter, and it must hold as much as 2 m of DNA, which is complexed into nucleosomes that during full extension are 11 nm in diameter, what percentage of the volume of the nucleus is occupied by the genetic material?
Each nucleotide pair of a DNA double helix weighs about 1 × 10 −21 g. The human body contains approximately 0.5 g of DNA. How many nucleotide pairs of DNA are in the human body? If you assume that all the DNA in human cells is in the B-DNA form, how far would the DNA reach if stretched end to end?
Refer to Figure 2 and compare this with the DNA model in Figure 1. a. In what ways are they similar? b. In what ways are they different? c. What is the biological significance of such differences? Why is the DNA referred to as the genetic material?
Which DNA fragment, A, B, C, D, E, or F, is the largest?Which two DNA fragments are the same size? Select all that apply. Which DNA fragment, B, C, D, or E is about the same size as the lengths of the fragment A and fragment F added together?
5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the previous question, starting at the second base.