1. Drag the red box to indicate the restriction site in the following sequence. 5-.. АТА ТСА TСС TGT GCT GCC TC ATC TCT GTG CCC ...-3' Attempts left: unlimited Check answer 2. Drag the green box to indicate the single base change or SNP in sequence 2. 1) 5'-... АТА ТСА ТCС TGT GCT GCС TTC ATC тст стG ССС ...-3' 2) 5'-... АТА ТСА ТCС TGT GTT GСС ТTC ATC тст сTG сСС ...-3'

1. Drag the red box to indicate the restriction site in the following sequence. 5-.. АТА ТСА TСС TGT GCT GCC TC ATC TCT GTG CCC ...-3' Attempts left: unlimited Check answer 2. Drag the green box to indicate the single base change or SNP in sequence 2. 1) 5'-... АТА ТСА ТCС TGT GCT GCС TTC ATC тст стG ССС ...-3' 2) 5'-... АТА ТСА ТCС TGT GTT GСС ТTC ATC тст сTG сСС ...-3'

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 9SQ: An individuals set of unique _______ can be used in DNA profiling. a. DNA sequences b. short tandem...

See similar textbooks

Similar questions

An individuals set of unique _______ can be used in DNA profiling. a. DNA sequences b. short tandem repeats c. SNPs d. all of the above
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer present
In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain pneumonia solutions were added to non-virulent R Strain pneumonia cell cultures and allowed to grow in liquid media (i.e., broth). In tubes where DNAase was added to the supernatant prior to cell culture, what was the observed effect when plating and growing the S. pneumonia cells to solid media? a All RNA was degraded and Transformation of the R Strain to S Strain occurred. b All Protein was degraded and Transformation of the R Strain to S Strain occurred. c All DNA was degraded and Transformation of the R Strain to S Strain did not occur. d All RNA was degraded and no Transformation occurred indicating RNA is the molecule of Transformation inheritance e None of the above are true
A student cloned Claudin 1 (877 bp) gene into pTRE3G-BI-ZsGreen1 (total size is 8905 bp) vector using Not1 and EcoRV restriction sites located at 215bp and 779bp respectively. What is the size of the recombinant plasmid? A) 9782 bp B) 9218 bp C) 10776 bp E) 8028 bp F) None of the answers given
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?
The total size of the plasmid is 2686 bp. There is a PstI recognition site at position 439, HindIII recognition site at position 447, and ScaI recognition site at 2179. If restriction enzymes ScaI and HindIII are used to cut this plasmid, what would be produced? a. 2 fragments: 954bp and 1732bp b. none of the choices apply c. 1 linear fragment of 2686bp d. 3 fragments: 447bp, 507bp and 1732bp
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
In a random sequence consisting of equal proportions of all four nucleotides, what is the average distance between consecutive occurrences of the restriction sites for the Apa I 5'-GGGCCC-3'? a once every 64 bp b once every 128 bp c once every 256 bp d once every 4,096 bp
The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence forthe enzyme BamHI—GGATCC—the four internal bases areidentical to the Sau3AI sequence. The single-stranded endsproduced by the two enzymes are identical. Suppose youhave a cloning vector that contains a BamHI recognitionsequence and you also have foreign DNA that was cut withSau3AI. Can this DNA be ligated into the BamHI site of the vector,and if so, why?