Answered: 10. (a) What are exon and intron?…

10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different proteins can be prepared from the same gene.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 17TYK

See similar textbooks

Related questions

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: 5 How RNA processing splices out introns and joins adjacent exons

A: RNA is a long chain of ribonucleotides connected together via phosphodiester bonds. It works in gene…

Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…

A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…

A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…

Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…

A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…

Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…

A: The given figure shows the presence of 3 exons and 2 introns. Exon 1 starts from bp 50 to bp 600.…

Q: 1. What sequences form most of the human genome? What is their significance in the expression of…

A: The Alu sequence is known form most of the human genome, it is the most frequent sequence and occur…

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells?…

A: The chemicals or the drugs that are employed to kill bacteria are termed antibiotics. The regulation…

Q: 1a) What amino acid would be coded for by the codon 5'AGG3'?

A: Codons are the trinucleotide sequences of DNA or RNA that specifies amino acids. There are 20 amino…

Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…

A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 10. List three examples of stop codons. a) .. b) .... c)

A: Genetic code It is a dictionary that corresponds with sequence of nucleotides and sequence of amino…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…

A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: The specific sequence component of the bacterial promoter located 10 base pairs upstream of the…

A: A promoter is cis-acting , position dependent DNA sequence which is necessary for accurate and…

Q: 1. What term is referred to the process of removing large portions of the RNA primary transcript…

A: Introduction :- Splicing is the process of excising introns (noncoding sections of genes) from…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: All of the following are functions of introns EXCEPT A. Provide buffering capacity against mutations…

A: Introns are non coding sections of RNA transcripts that are removed by splicing before the…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…

A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…

A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…

Q: 1) List 5 factors involved in the process of either initation or elongation of translation

A: Translation is the process by which the genetic code contained within an mRNA is decoded to produce…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

Q: (D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting…

A: mRNA: Messenger RNA It is a type of RNA that plays a very important role in protein synthesis…

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on…

A: The correct option is (C) a sequence upstream of the AUG initiation codon on mRNA.

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…

A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: 4. a) Explain what is meant by the term "alternative splicing" b) what does it help to explain?

A: The process by which introns, the noncoding regions of genes, are excised out of the primary…

Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…

A: Need to fill the blanks related to transcription process.

Q: 1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when…

A: Translation is the phenomenon in which the ribosomes present in the cytoplasm carry out the process…

Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…

A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…

Q: 1) Transcription and translation both involve an initiation, elongation, and termination phase.…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Describe Information Transfr Replicetion - Transcuiption Tronslation

A: Genes and genomes play an important role in information processing. The genetic material of the cell…

Q: 1. What are the three RNA processings in eukaryotic cells?

A: RNA processing is the term collectively used to describe the sequence of events through which the…

Question

( please give answer in simple language and draw diagram where necessary)

10. (a) What are exon and intron? Explain the
process of RNA splicing to highlight
that different proteins can be prepared
from the same gene.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

6. What codons ar e found in the mRNA for the two mutated DNA?
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when the ribosome reaches a stop codon?
2b) What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
1a) What amino acid would be coded for by the codon 5'AGG3'?
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?
1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine.
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. Identify the major types of RNA in a cell and discuss their individual functions in relation to protein synthesis. 2. Compare the structural differences of sugars and bases in DNA and RNA molecules 3. What processing events differentiate eukaryotic mRNA from prokaryotic mRNA?
1. Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?