1. You are provided with the DNA sequence in the leading strand template. See item number 1 in worksheet, row A. information asked for in the succeeding rows: Supply the row B: supply the bases in the complementary strand. row C: Assuming that the sequence in the row A is the template for transcription, supply the bases of the mRNA transcript. Label the 5' and 3' ends. row D: Identify the amino acids that comprise the polypeptide chain as the ribosome would have identified them. Just merge cells before you label the amino acids based on the codes. Label the 5' and 3' ends.

1. You are provided with the DNA sequence in the leading strand template. See item number 1 in worksheet, row A. information asked for in the succeeding rows: Supply the row B: supply the bases in the complementary strand. row C: Assuming that the sequence in the row A is the template for transcription, supply the bases of the mRNA transcript. Label the 5' and 3' ends. row D: Identify the amino acids that comprise the polypeptide chain as the ribosome would have identified them. Just merge cells before you label the amino acids based on the codes. Label the 5' and 3' ends.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence. 5'ACTGCTATGATTGGCTTAGCTGCGTGGACCGTGTCATAGACTGGCT 3' 1. First use this strand as a blueprint to write the Base sequence of a DNA strand that is complementary to this one. 2. Transcribe the complimentary DNA strand that that you made in question 1 into mRNA, and write the mRNA sequence. 3. Finally, use the genetic code dictionary to translate the mRNA that you made in question 2 into the appropriate amino acid sequence.
The following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.
The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA sequence 1: CTTTTTTGCCAT DNA sequence 2: ACATCAATAACT DNA sequence 3: TACAAGGGTTCT Determine the mRNA sequence that you would derive from transcription of each strand Using the genetic code table, show the amino acid sequence that will be encoded by these mRNAs For the 3 DNA sequence, what will be the sequence of the complementary base after the process of replication?
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
Convert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based from theresulting sequence in the anticodons of tRNA,determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code.1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAGmrNa:tRNA:Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GACmrNA:tRNA:Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATTmrNa:tRNA:Amino acid sequence:
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
To test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. Partner DNA strands the mRNA strands the tRNA the formed amino acids the discussion of the entire procedure
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.