16a) The Iron Response Factor (IRF) is an RNA binding protein that recognizes and binds to a specific sequence, known as the Iron Response Element (IRE), when intracellular iron levels are low, but not when intracellular iron levels are high. Briefly explain in general terms what happens as intracellular iron levels increase that causes the IRF protein to lose its capacity for binding to the IRE sequence in RNA.

16a) The Iron Response Factor (IRF) is an RNA binding protein that recognizes and binds to a specific sequence, known as the Iron Response Element (IRE), when intracellular iron levels are low, but not when intracellular iron levels are high. Briefly explain in general terms what happens as intracellular iron levels increase that causes the IRF protein to lose its capacity for binding to the IRE sequence in RNA.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

Using the quarternary structure of hemoglobin shown inFigure 9-3(d), explain in structural terms how a mutation in the β subunit protein could be suppressed by amutation in the a subunit gene.
The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?
. You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the 5′ end of theRNA transcript. However, much to your surprise, all theenzymes required for capping are normal. You determine that the mutation is, instead, in one of the subunitsof RNA polymerase II. Which subunit is mutant, andhow does this mutation result in failure to add a cap toyeast RNA?
38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table.
The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.
During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Before the technology existed to synthesize RNAmolecules of defined sequence like those in Fig. 8.5,similar experiments were performed with syntheticmRNAs of undefined sequence. For example, RNAsconsisting only of Us and Gs could be synthesized invitro, but they would have random sequences. Supposea pool of random-sequence RNAs was synthesized ina reaction mixture containing three times as much UTPas GTP, and that the resulting RNAs were translatedin vitro.a. How many different codons exist in the RNAs?b. How many different amino acids would you find inthe polypeptides synthesized?c. Why are your answers to (a) and (b) not the same?d. How often would you expect to find each of thecodons in (a)?e. In what proportions would you expect to find eachof the amino acids in the polypeptides?f. If you did this experiment—that is, synthesizedrandom-sequence RNAs containing a 3:1 ratio ofU:G, and quantified the amount of each amino acidin the polypeptides produced—prior to knowledgeof the genetic…
The CTD of the largest subunit of RNA polymerase II can be phosphorylated at multiple serine residues. What are the conditions that lead to the phosphorylated versus nonphosphorylated RNA polymerase II CTD?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.