Anticodon Anticodon Anticodon 3 1 5'-IAG-3' 5'-UAU-3' 5'-AAA-3' codon MRNA 5'- -3' 5' _3' 3' 5' 3. 1 letter amino acid
Q: Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A C. D. F Three…
A: Nucleus is main controller of the cell which carries genetic material . It also contain thread like…
Q: How many tRNA molecules can associate with a ribosome at any given time during translation
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: What is the name for the complex that forms when many ribosomes translate the same MRNA at the same…
A: Polyribosomes are the complex of multiple ribosomes which translates the same mRNA.…
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: 21a. Fill in the blanks to label each type of molecule in this figure. asp a.TRNA b.amino acids leu…
A: The synthesis of proteins takes two steps: transcription and translation. Transcription takes the…
Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…
A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…
Q: spings gating its gen ISlation from this organism and use it to translate (in a test tube) some RNA…
A: The nucleotide in a DNA is a group which is arranged in a linear sequence in a DNA which contains…
Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…
A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…
Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…
A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…
Q: All of the following are stop codons, except 1. UAA 2. AUG 3. UAG 4. UGA
A: The template DNA strand is transcribed into mRNA on which the nucleotides are arranged in the form…
Q: The anticodon of a tRNA is 5' AAU 3' Part A What codon does the tRNA recognize? What amino acid does…
A: Transfer ribonucleic acid or tRNA is a small molecules which helps in translation of mRNA into…
Q: if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the…
A: A transfer RNA (tRNA) is a type of RNA molecule whose primary function is to match an mRNA codon…
Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: A tRNA in E. coli charged with His (histidine) would have the anticodon:
A: Translation -- the process of formation of proteins from the RNA tRNA are the type of RNA which…
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…
Q: Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’…
A: The terms used in the question represents the molecules involved in gene expression. A gene is a…
Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…
A: The genetic material has various components on which the transcriptional and translational machinery…
Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…
A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides. We…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: Transcript the template DNA (write in mRNA codons) *
A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…
Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…
A: Gene expression includes transcription and translation. It leads to synthesize mRNA and protein…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: A tRNA that has the anticodon GAG carries which amino acid?
A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…
Q: Which of the following sequences would NOT be found as an anticodon in a tRNA? Question 35 options:…
A: The translation process that takes place in living cells helps the production of proteins from the…
Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in…
A: The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…
Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…
A: Within the biological system, the flow of genetic information is explained as molecular biology's…
Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…
A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a…
A: DNA => Transcription => mRNA => Translation => Protein Protein synthesis is ribosome…
Q: 新 22 e codon is 5' 5'-GAA-3'. O 3'-GAA-5'. 3'-CTT-5'. O 3'-CUU-5' O 5-CUU-3
A: An anticodon is a trinucleotide sequence that is complementary to a codon in an mRNA sequence.
Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…
A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…
Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…
A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…
Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…
A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…
Q: DNA ONA 200000 700000 -MRNA Polypeptide- Chain Polypeptide- Chain Ribosome MRNA Ribosome Student 1…
A: The process of the formation of mRNA from the DNA strand is known as transcription. It is the first…
Q: Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together…
A: The central dogma is a process that includes transcription (production of RNA from DNA) and…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…
A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…
Q: Table 9-2 Transcription of Oxytocin DNA Triplets ACG ATG TAT GTT TTG ACG GGA GAC C mRNA ACA AUC AUA…
A: A mRNA codon constitutes a group of three nucleotide bases. Each codon codes for a particular amino…
Q: 16. Translation codon termination in eukaryotes all except: B. UGA A. UAC C. UAG D. UAA
A: introduction Translation is the process of creating polypeptides from an mRNA transcript that was…
Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…
A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…
Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…
A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: tRNA with the anticodon 5'AGG3' carry
A: The basic constitutional unit of proteins is the amino acids. There are a total of 20 amino acids…
Q: 10.9 the beginning of a gene and five different mutations of this the base-pairing rules to complete…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Step by step
Solved in 4 steps
- A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
- The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-LysThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?
- There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?
- 1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.