Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together MRNA 5' Cap Poly-A tail 1-146 5' UTR 3' UTR Coding segment © 2011 Pearson Education, Inc. Which of the following will excise the introns (non-coding regions) of the mRNA molecule? A.Spliceosomes B.RNA Polymerase C.Primase D.DNA Polymerase I by virtue of its exonuclease activity
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there…
A: DNA to RNA is transcription and RNA to protein through tRNA anticodon gives a protein sequence.
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: Splice sites are recognized by GU (5' splice site) and AG (3' splice site), which signals the…
Q: The following questions refer to this diagram of a mature mRNA. 1) Which two sequences shown in…
A: mRNA is messenger RNA that takes the message of a gene from DNA and then converts it into protein.
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…
A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…
Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…
A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…
Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…
A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…
A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…
A: Codon It is the three consecutive sequence of a mRNA that code for amino acid.
Q: 5’ UUGCAUUGCAGC 3’ Write out ALL of the possible reading frames for the RNA shown in…
A: The DNA acts as the genetic material of a living organism. This DNA generally gets replicates to…
Q: An mRNA has a sequence 3'-AAAUUACUCGAAAUUGCGUGUAGU5'. a) What would be the DNA, t-RNA and amino acid…
A: Points to know : The fundamental process of protein synthesis is the formation of peptide bond…
Q: What is one function of the 5' cap in eukaryotic mRNA? Select one: a. It is involved in translation…
A: Transcription is the process in which the RNA is synthesised from the DNA that is present in the…
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template…
A: DNA acts as the template for mRNA synthesis. The mRNA has the same sequence as the coding strand of…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Select the description of an intron. (If possible, please explain why it is that answer) a.)…
A: Pre-mRNA contains both introns and exons in it's sequence. This pre-mRNA then undergoes modification…
Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…
A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…
Q: 55 __________________ assemble to form a spliceosome, the splicing machine that excises introns. A.…
A: Introduction Transcription is a process where mRNA is produced from DNA. After transcription mRNA…
Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…
A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…
Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…
A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.
Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…
A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…
Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…
A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: Transcription is the process in which RNA is synthesized from DNA.
Q: As opposed to DNA replication or transcription, translation requires the correct reading frame.…
A: A double-stranded DNA molecule can read in any of six possible reading frames- three in the forward…
Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…
A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: Consider the following gene with their respective introns and exons 5’ –…
A: Since you have asked multiple questions, we will solve the first three question for you. If you want…
Q: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene depicted in Figure 14.12a.…
A: Alternative processing and splicing results in the production of multiple mRNA and proteins from the…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…
A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…
A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…
Q: ook at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the…
A: Note- According to the guidelines, only the first three questions can be answered out of MCQs.…
Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…
A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…
Q: The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or…
A: Mature-messenger RNA often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been…
Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…
A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A.…
A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…
Q: A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new…
A: A mutation is a change in the nucleotide sequence of the DNA of an organism. Mutations can be caused…
Q: 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: 1.(a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: The intron boundary (5' splice site) generally starts with GU sequence. The consensus sequence of 5'…
Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…
Q: Which of the following statements about RNA processing in eukaryotes is INCORRECT? A. The excision…
A: The pre mRNA is converted into mrna before it's exist outside the nucleus in eukaryotes.
Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…
A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…
Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: MRNA 1 20 ORI 40 60 TТCGAGCTCTCGТССТCGAGATACGCGATGATATTACTGGTAАТАТСGGGAТССАСТАТС…
A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the…
Q: As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base…
A: A mutation will take place when a DNA gene is either damaged or changed so that it alters the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)55__________________ assemble to form a spliceosome, the splicing machine that excises introns. A.snRNAb.tRNAc.Micro RNAD.rRNAs 56Eukaryotic initiator tRNA is charged with a formylated methionine. Yesorno 57Eukaryotic mRNA can be purified by separating molecules a mixture of total RNA by: A.Oligo (dG) cellulose chromatographyb.Oligo (dT) cellulose chromatographyc.Oligo (dC) cellulose chromatographyD.Oligo (dA) cellulose chromatographyShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
- 37Transposons in eukaryotes are mechanistically different from bacterial transposons. Yesorno 38The tRNA has a ( ) secondary structure. 39A single ( ) can be processed to produce two molecules or more different mRNAs.The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).The human α-tropomyosin gene is alternativelyspliced to produce different forms of α-tropomyosinmRNA in different cell types (Figure Q6–3). For all forms ofthe mRNA, the protein sequences encoded by exon 1 arethe same, as are the protein sequences encoded by exon10. Exons 2 and 3 are alternative exons used in differentmRNAs, as are exons 7 and 8. Which of the following state-ments about exons 2 and 3 is the most accurate? Is thatstatement also the most accurate one for exons 7 and 8?Explain your answers.A. Exons 2 and 3 must have the same number ofnucleotides.B. Exons 2 and 3 must each contain an integral num-ber of codons (that is, the number of nucleotides dividedby 3 must be an integer).C. Exons 2 and 3 must each contain a number ofnucleotides that when divided by 3 leaves the sameremainder (that is, 0, 1, or 2).
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yesorno 74Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A.noncodingb.long terminal repeatc.split geneD.enhancer 75Which of the following cleaves the N-terminal methionine from polypeptides?A.Methionine isomeraseb.Methionine aminopeptidasec.Methionine carboxylaseD.Methionine transferase
- mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’34The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA. Yesorno 35 ( ) can be used to purify transcription activator proteins 36A mutation that adds or deletes a base pair in the open reading frame and is termed a ( ) mutation.A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?