Please ASAP. Thank you nekaystc els produces somenhat difrent proteins from a single gene. The different forms of the proteins that are the products of a single gene are called: Atermative splicing of MRNAS in eukaryotic cells produces somewhat different proteins from a single gene. The different forms cO isoformsO sotopes1somersO isotonic

Alternative splicing is the modification process of RNA(mRNA) by which an nascent mRNA is converted…

Answered: Atematve splicing of MRNAS in…

Atematve splicing of MRNAS in eukaryotic cells produces somewhat different proteins from a single gene. The different forms c O soforms O satopes O isomers O sotonic

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 14P: The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point...

See similar textbooks

Related questions

Q: Eukaryotic transcription requires a "cap" at one end and a "tail" at the other end of each mRNA…

A: Eukaryotic transcription is the process that eukaryotic cells use to copy genetic material through…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…

Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…

A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…

Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…

A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…

A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine…

A: Trypanosomes are single-celled parasitic protozoa. This parasite causes sleeping sickness in humans.…

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The gene comprises the…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: Interaction between and of the mRNA is required for…

A: The genetic code embedded in a messenger mRNA molecule is translated to generate a particular…

Q: In group II introns, the splicing reaction is initiated by an internal O purine pyrimidine O both…

A: Purine : Adenine and Guanine Pyrimidine: Thymine and cytosine

Q: In bacteria, since the mRNA does not require any processing to become active, and also since…

A: The cells are the primary unit of life. An organism may be unicellular or multicellular. The…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studies by…

A: Please follow step 2 for detailed explanation.

Q: Prokaryotic mRNAs are polycistronic such that ribosomescan translate several different polypeptides…

A: A monocistronic mRNA is defined as a messenger RNA (mRNA) that encodes one protein. The eukaryotic…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: A _____________________ is a purine-rich sequence closeto AUG (the initiation codon) on a…

A: The preinitiation complex is a complex of approximately 100 proteins that is necessary for the…

Q: All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the…

A: Removal of intron sequences is splicing.

Q: c. On the mature mRNA transcript in eukaryotes, start codon is not found at the beginning of the 5'…

A: Mature mRNA transcripts in eukaryotes are those eukaryotic RNA transcripts that have been spliced…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…

A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…

Q: One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studies by…

A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…

Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…

A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…

Q: Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA…

A: Translation is the process of synthesis of protein from mRNA . So , RNA serves as a template . But ,…

Q: C G T G T G GAGCT A A.. 3' 5'..A TG GCG CTGTGA AGC TA A.. 3' 5 . .A TGG CGCT CTG GAGCTA A.. 3' on…

A: Mutations of the spontaneous change in the DNA molecule. Synonyms mutations does not change the…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: Exon E10 E15 ..... .... RNA (protein) N Give TWO explanations as to how widely separated parts of a…

A: Exon are basically the functional parts of a gene which code for a functional protein. On the other…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: A TRNA molecule with the anticodon GCU would be carrying the amino acid: Secend ha f cod Three-er…

A: Ribonucleic acid (RNA) comprises a Ribose sugar along with a phosphate group and nitrogenous bases.…

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are…

A: The process of translation is initiated by the start codon which is a nucleotide triplet situated in…

Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…

A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…

Q: The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA…

A: Genetic codes are used to translate the information encoded within the genetic material. A codon is…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: Eukaryotic gene expression. The following pre-MRNA undergoes splicing and contains a single open…

A: The change the nucleoitide sequence will affect the sequence of the polypeptide chain and causes…

Q: Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to…

A: Ribonucleic acid interference is the technique that can potentially inhibit the function of a…

Q: the difference in primary structure between related tropomyosin informs arises from a) alternative…

A: The primary structure of proteins means amino acid sequence which is synthesized during the protein…

Q: In a study of several families for differences in the sequence of a particular gene suspected to…

A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…

Q: Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such…

A: Alternative RNA splicing is a fundamental post-transcriptional regulatory process that results in a…

Q: The primary transcripts produced in bacteria are the mature mRNAS ready for Bacterial cells use one…

A: 1.The primary transcripts produced in bacteria are the mature mRNAs ready for translation: TRUE…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.

Q: All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the…

A: The process by which introns are removed from heterogeneous nuclear RNA to form mRNA is called…

Q: An RNA sequece includes 15 codons. How amny animo acids does this sequence encode?

A: The central dogma was given to depict the flow of genetic information. It includes various…

Question

Please ASAP. Thank you

nekaystc els produces somenhat difrent proteins from a single gene. The different forms of the proteins that are the products of a single gene are called:

Atermative splicing of MRNAS in eukaryotic cells produces somewhat different proteins from a single gene. The different forms c
O isoforms
O sotopes
1somers
O isotonic

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point formed during mRNA splicing: the invariant A. its 5â€™-R neighbor, its 3â€™-Y neighbor, and its 2â€™-G neighbor.
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause a protein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has been deleted?
the difference in primary structure between related tropomyosin informs arises from a) alternative splicing b) C-to-U editing c) farnesylation d) H3K4 methylation e) targetting to secretory vesicles
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projections
Which of the following mechanisms may create multiple mRNAsfrom the same gene?a. posttranslational controlb. alternative mRNA splicingc. binding of a transcription factord. chromatin remodelinge. miRNAs
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
For each of the following types of gene regulation, indicate whether it occurs in eukaryotes only, in prokaryotes only, or in both prokaryotes and eukaryotes.a. differential splicingb. positive regulationc. chromatin compactiond. attenuation of transcription through translation ofthe RNA leadere. negative regulationf. translational regulation by small RNAs
Some point mutations lead to an mRNA that produces a shorterpolypeptide. This type of mutation is known as a ___ mutation.a. neutralb. silentc. missensed. nonsensee. chromosomal
How would the artificial mRNA5′. . . GUGUGUGU . . . 3′be read according to each of the following models forthe genetic code?a. two-base, not overlappingb. two-base, overlappingc. three-base, not overlappingd. three-base, overlappinge. four-base, not overlapping
Which of the following statements regarding splicing in eukaryotes is correct?a) Several reactions in the splicing process involve hydrolysis of ATPb) Exons are spliced out and introns are retained in the mature mRNA transcriptc) Splicing takes place in the cytosold) Small nuclear RNAs are retained in the mature mRNA transcript