Choose the correct function of tRNA. O A, TRNAS are an intermediate stage of RNA processing where introns have been removed but polyadenylation has not occurred yet O B. tRNAS are small RNAS that regulate gene expression O C ERNAS bring amino acids to the ribosome for addition to the growing polypeptide chain O D. RNA is a major structural component of the ribosome
Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…
A: Translation is the mechanism which enables ribosomes in the cytoplasm or endoplasmic reticulum to…
Q: Can you please answer number 31
A:
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…
A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…
Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…
A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…
Q: Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate…
A: The process of translation converts the information carried by messenger RNA from DNA into a…
Q: Charging TRNAS entail: All of these choices are correct. O Proper recognition between the anticodon…
A: t RNA charging occurs in translation process where protein synthesis occured from mRNA.
Q: Draw a tRNA that would recognize the codon 5’ A U G 3’. What is the sequence of this tRNA’s…
A: The tRNA (transfer RNA) take part during the translation process. It is responsible for delivering…
Q: The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing…
A: tRNA is the transfer RNA . It is the smallest of three major species of RNA molecule. They transfer…
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…
A: Question - Termination of translation occurs when: a charged tRNA gets stuck in the E site…
Q: The anticodon of a tRNA is 5' AAU 3' Part A What codon does the tRNA recognize? What amino acid does…
A: Transfer ribonucleic acid or tRNA is a small molecules which helps in translation of mRNA into…
Q: Please help me discuss this 2 question. Thank you so much. 1. how does pre mRNA is formed in the…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of a specific…
Q: In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These…
A: Codon is located on mRNA while anticodon is on tRNA. Anticodons specifically identifies and pair to…
Q: Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of…
A: Translation is the process of converting the mRNA to proteins Proteins are made of amino acids. The…
Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…
A: Introduction:: The correct choice is option (b).
Q: If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the…
A: Genetic code are nucleotide or nucleotide sequences of nitrogenous bases which particularly specify…
Q: True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be…
A: Proteosome is barrel saved complex structure, contain high amount of structure that is responsible…
Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…
A: Inside the nucleus of the cell , DNA act as a template for the manufacturing of single strand of…
Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…
A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: Translation uses energy from all but O ATP hydrolysis O GTP hydrolysis O acetylation O cleavage of…
A: Since you have asked multiple questions, according to our guidelines we are eligible to answer only…
Q: A tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the…
A: Transfer RNAs (tRNAs) are the adaptor RNA molecules that serve to carry the amino acids from the…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: tRNA It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…
Q: The genetic code derives its specificity through what interactions? O hydrogen bonds that maintain…
A: Genetic code: - Triplet - 64 different codons - 61 sense codons and 3 stop codons - Nearly universal…
Q: 37 Transposons in eukaryotes are mechanistically different from bacterial transposons. Yes or no…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of…
A: An anticodon is a RNA triplet complementary to the triplet on mRNA coding for their cargo amino…
Q: A. rRNA is used to transfer amino acids to the ribosome. make up the large ribosomal subunit. make…
A: Introduction :- Ribosomal RNA (rRNA), a molecule in cells that is exported to the cytoplasm and is a…
Q: What determines the amino acid that is attached to an uncharged tRNA? OI. Its peptidyl transferase.…
A: The correct answer is iv) aminoacyl tRNA Synthetase
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: Which of the following statement(s) about "wobble" base is/are correct? Please make sure to select…
A: The tRNA and mRNA interaction occurs during the translation (protein synthesis) process. The tRNA…
Q: The aminoacyl- RNA synthetase enzymes are responsible for: O A. matching each TRNA with the…
A: Aminoacyl-tRNA synthetases enzymes is used in protein biosynthesis during translation process.…
Q: In bacteria, but not in archaeans, the amino group of the methionine of the initiator tRNA is…
A: Introduction: Amino acids are biomolecules comprised of two functional groups; amino (NH2) and…
Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…
A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…
Q: A charged tRNA is approaching the ribosome during the translation of an mRNA. The anti-codon…
A: Translation, as related to genomics, is the process through which information encoded in messenger…
Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…
A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…
Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…
A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices. in…
Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…
A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…
Q: below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: Which statement BEST DESCRIBES the tRNA structure? Chooose from the options below. Amino acids bind…
A: Introduction :- The three hairpin loops that make up the tRNA molecule's characteristic folded…
Q: Questión 15 The following statements best describes the RNA structure EXCEPT A it is usually single…
A: Answer : Option D is correct. - according to the question asked above, option (d) cannot describe…
Q: T A C C A G A T A C A C T C C C C T G C G A C T into an mRNa sequence and a…
A: The central dogma explains the flow of genetic information from DNA to RNA and then to protein. It…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…
Q: What is the importance of the anticodon on the tRNA?
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: The first aminoacyl-TRNA that binds to the ribosome: a. is a special fMet-tRNAet in prokaryotes. b.…
A: mRNA transcribed from nucleic acid will be translated into peptide sequence by ribosome. Ribosome…
Q: A tRNA has the anticodon sequence 3′–CAG–5′. What amino acid does it carry?
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: forms hydrogen bonds with its own bases to form a clover leaf/ key like structure (a) mRNA (b)…
A: Hydrogen bonds are formed between the complementary bases of the nucleotides of the RNA or DNA.…
Q: The S-D (shine-Dalgarno) sequence is part of O a. 23S RNA in 50s subunit O b. 6S rRNA in 50S subunit…
A: Introduction In Bacterial And Archaeal Messenger RNA, The Shine–Dalgarno (SD) Sequence Is A Ribosome…
Q: tRNAs are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA molecule. B. When a tRNA has an amino acid attached to it, it is considered to be a charged tRNA C. Synthetases are not important to tRNA D. Amino acids are linked to tRNAs with hydrogen bonds
- Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino AcidsWhich of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translationNumber the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
- The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small ribosomal subunit d. the large ribosomal subunitWhat site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its amino acid to the growing chain of amino acids? a. E site b. P site c. A site d. the small ribosomal subunit Please respond as soon as possibleNumber the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
- A release factor is referred to as a “molecular mimic” because its structure is similar to a. a ribosome. b. an mRNA. c. a tRNA. d. an elongation factor.The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.___________ forms hydrogen bonds with its own bases to form a clover leaf/ key like structure (a) mRNA (b) tRNA (c) rRNA (d) amino-acyl tRNA synthetase (e) ATP synthetase