Codons Found in Messenger RNA Second Base A G Cys U Cys Stop Trp Phe Ser Tyr Tyr Stop Stop Phe U Leu Ser Ser A Leu Ser Pro His Arg Arg Arg G Leu U Leu Pro His Leu Pro Gln Leu Pro Gln Arg lle Thr Asn Ser lle Thr Asn Ser A lle Thr A Lys Lys Arg Arg Gly Met Thr Val Ala Asp Asp U Gly A Val Ala Val Ala Glu Gly G Val Ala Glu Gly Following the format: MRNA: (answer); TRNA: (answer); amino acid: (answer); write the corresponding MRNA, TRNA, and amino acid of the given DNA strand: TAC TAA AGC ATT. Refer to the codon chart below for the amino acids. * Your answer Left Strand: TAC TAA AGC CTG * Your answer First Base Third Base

Codons Found in Messenger RNA Second Base A G Cys U Cys Stop Trp Phe Ser Tyr Tyr Stop Stop Phe U Leu Ser Ser A Leu Ser Pro His Arg Arg Arg G Leu U Leu Pro His Leu Pro Gln Leu Pro Gln Arg lle Thr Asn Ser lle Thr Asn Ser A lle Thr A Lys Lys Arg Arg Gly Met Thr Val Ala Asp Asp U Gly A Val Ala Val Ala Glu Gly G Val Ala Glu Gly Following the format: MRNA: (answer); TRNA: (answer); amino acid: (answer); write the corresponding MRNA, TRNA, and amino acid of the given DNA strand: TAC TAA AGC ATT. Refer to the codon chart below for the amino acids. * Your answer Left Strand: TAC TAA AGC CTG * Your answer First Base Third Base

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
look at the code: import random # Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"] # Define the codon-to-amino acid dictionarycodon_table = { "AUG": "M", # Start codon "UUU": "F", "UUC": "F", "UUA": "L", "UUG": "L", "UCU": "S", "UCC": "S", "UCA": "S", "UCG": "S", "UAU": "Y", "UAC": "Y", "UAA": "*", # Stop codon "UAG": "*", # Stop codon "UGU": "C", "UGC": "C", "UGA": "*", # Stop codon "UGG": "W", "CUU": "L", "CUC": "L", "CUA": "L", "CUG": "L", "CCU": "P", "CCC": "P", "CCA": "P", "CCG": "P", "CAU": "H", "CAC": "H", "CAA": "Q", "CAG": "Q", "CGU": "R", "CGC": "R", "CGA": "R", "CGG": "R", "AUU": "I", "AUC": "I", "AUA": "I", "AUC": "I", "ACU": "T", "ACC": "T", "ACA": "T", "ACG": "T", "AAU": "N", "AAC": "N", "AAA": "K", "AAG": "K", "AGU": "S", "AGC": "S", "AGA": "R", "AGG": "R", "GUU": "V", "GUC": "V", "GUA": "V",…
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’ Coding Strand -> 3’ - C G G T C C A G T C C A - 5’ m-RNA -> 5’ - G C C A G G U C A G G U - 3’ Amino acid sequence of peptide -> Ala Arg Ser Gly In which molecule do you find the code sequence, the codon sequence, and the anti-codon sequence within their structure? Find the codon sequence and the anti-codon sequence.
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3