Explore:Codons Found in Messenger RNASecond BaseU C ACys uCys cStop AGPheSerTyrTyrStopStopHisPheSerLeuSerLeuSerTrpLeuProArgArgArgGLeuProHisLeuProGinLeuProGlnArgleThrAsnSerUAlleThrAsnSerleThrALysLysArgArgGlyGlyAMetThrValAlaAspValGValAlaAspGluAlaGlyGlyValAlaGluMutation #1:• Change the Mutation to REDOriginal DNA Sequence:TACAC CTTGG CCGACGACTmRNA Sequence:A UGUG GA ACCG CUG C UGAAmino Acid Sequence:MET -TRP- ASN - ARG- CYS - (STOP)MutatedTAC ATC TTG GCG ACG ACTDNAmRNAAUGAmino AcidМЕТ-MET -Will thismutationhave aneffect?What kind ofmutation isthis?First BaseThird Base

Name: Explore:Codons Found in Messenger RNASecond BaseU C ACys uCys cStop A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Explore:Codons Found in Messenger RNASecond BaseU C ACys uCys cStop AGPheSerTyrTyrStopStopHisPheSerLeuSerLeuSerTrpLeuProArgArgArgGLeuProHisLeuProGinLeuProGlnArgleThrAsnSerUAlleThrAsnSerleThrALysLysArgArgGlyGlyAMetThrValAlaAspValGValAlaAspGluAlaGlyGl

Nucleic acids are made up of nucleotides. Ribonucleic acid and Deoxyribonucleic acid are polymers…

Science

Biology

Explore: Codons Found in Messenger RNA Second Base UC A Cys U Cys c Phe Ser Tyr Туг Stop Stop Phe Ser Leu Ser Leu Ser Trp Arg Arg Arg Arg Leu Pro His Leu Pro His Leu Pro Gin Leu Pro Gin lle Thr Asn Ser lle Thr Asn Ser lle The Lys Lys Asp Asp Arg Arg Gly Gly Met Thr Val Ala Val Ala G Val Ala Glu Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED TACACC TIG G C GACGACT AUGUG G A ACC G C UG CUG A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- Will this mutation have an effect? What kind of mutation is | this? First Base DCAGU CAGUCAGUCAG Third Base

Explore: Codons Found in Messenger RNA Second Base UC A Cys U Cys c Phe Ser Tyr Туг Stop Stop Phe Ser Leu Ser Leu Ser Trp Arg Arg Arg Arg Leu Pro His Leu Pro His Leu Pro Gin Leu Pro Gin lle Thr Asn Ser lle Thr Asn Ser lle The Lys Lys Asp Asp Arg Arg Gly Gly Met Thr Val Ala Val Ala G Val Ala Glu Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED TACACC TIG G C GACGACT AUGUG G A ACC G C UG CUG A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- Will this mutation have an effect? What kind of mutation is | this? First Base DCAGU CAGUCAGUCAG Third Base

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?
VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.
Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct
Locate a gene expression data set on Gene Expression Omnibus using "expression by hybridization" involving Rabies virus or related virus Use GEO2R to perform pairwise group analysis Explore and identify the most regulated genes: gene/protein functions of Rabies virusand Define the significance of these genes/proteins in the disease process.
Examine the following sequence of DNA3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’Write out the complementary DNA sequence (identify 3’ and 5’ ends)Write out the complementary mRNA sequenceWrite out the peptide sequence this DNA encodes
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)