Consider the following two peptides: I. Ile-Trp-Ala-Met and II. Glu-His-Cys-Thr Which peptide would be more soluble in water? Answer I or II.
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: centration Depicted below IS add one mole of each of the molecules as shown below. The molecule to…
A: Given, here is a cell membrane which separates a compartment in two sides. The compartments are…
Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…
A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…
Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Q: 1.In this model, the substrate still needs to fit into the enzyme like a key, but instead of simply…
A: Since you have posted multiple questions, we will provide the solutiononly to the first five…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: Create a concept map connecting diabetes and gluconeogenesis inhibitors
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Q: NADH boosts gluconeogenesis in the liver. So, what do you think about this assertion?
A: Gluconeogenesis is a pathway that produces glucose from pyruvate, lactate, glycerol, Gluconeogenesis…
Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase Phosphorylates glucose…
A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Which one of the following statements concerning the nature of fats is correct? Saturated fats are…
A: Simple fat or fat or triglycerides are fatty acid esters of glycerol. They serve as fuel reserves…
Q: Explain methods used in structural analysis of proteins
A: Proteins are polymers of amino acids. Each amino acid within a protein is linked by a peptide bond.…
Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…
A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Thiopurine S-methyltransferase (TPMT) is an enzyme that is responsible for the metabolism of the…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Assume that the experiments performed in the absence of inhibitors were conducted by adding 5 μL of…
A: We are asked to find some enzyme kinetics parameter that has a unit of s-1 . And in order to find…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: You are making 300 mL of MS-agar medium for plant tissue culture. You need 0.4 mg/LBAP and 0.8 mg/L…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: 1.b)Which one of the following would produce the most reliable evidence? in vitro study case report…
A: There are several different types of study designs that are used to gather evidence, each with its…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…
A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Answer 2 The Bose-Einstein Principle -Bose-Einstein condensate is a group of atoms cooled to within…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: What is the x-intercept for the above reaction on a Lineweaver-Burk plot? A. -0.5 per mM B. -1.0 per…
A: The Michaelis Menten equation: vo = vmax × [S]Km + [S] where vo is the initial rate of the…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: 8. The amino acid sequence for the beginning of the globular protein myoglobin is:…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The figure above represents changes in different types of metabolic pathways (y-axis) as energy…
A: Metabolism is the sum of all biochemical reactions in a living system that are responsible for it's…
Q: 4. What are the ABSORBABLE units of EACH of the FOUR Biological Molecules (Macromolecules) called?…
A: Macromolecules are large complex molecules which is formed from the polymerization of thousand of…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…
A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…
Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…
A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…
Q: The child who fainted was taken by ambulance to the hospital. Objectively: reflexes are absent,…
A: The following steps will explain how accumulation of a specific metabolite leads to appearance of…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: dentify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In…
A: Introduction There are 4 types of biomolecules present in our body, protein, carbohydrate, lipids…
Q: The rate of transformation of S, have been determined in the presence of two compounds M and N.…
A: Enzyme Inhibitors are the substances that can bind to enzyme and inhibit the enzyme activity . On…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: If the Vitamin C tablets are stored in a warm, humid bathroom cabinet, what might happen to the…
A: Vitamin C is also known as ascorbic acid. The important functions include maintaining healthy skin,…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: 3 4 Ag₂O NH₂OH, H₂O KMnO H₂O*
A: 3. This is an example of Tollens's reaction. Where Ag2O and NH4OH reacts to form ammonical silver…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If phenylalanine was not an essential amino acid, would diet therapy (the elimination of phenylalanine from the diet) for PKU work?Consider the following peptide: Lys-His-Asp-Glu-Phe-Cys-Ala-Asp-His-Arg What is the net charge of this peptide at pH = 1? What is the net charge of this peptide at pH = 14?Consider the peptides Ser-Glu-Gly-His-Ala and Gly-His-Ala-Glu-Ser. How do these two peptides differ?
- Identify and encircle the peptide bonds in this polypeptide (Leu-Pyr-Sec-Ile-Ser-Glu)?Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln Which amino acid/s is/are hydrophobic? Which amino acid/s is/are polar uncharged? Which amino acid/s is/are polar charged?Consider the following peptide sequence: Lys-Leu-Ile-Cys-Lys What is the net charge of this sequence at physiological pH? a. -2 b. +1 c. 0 d. -1 e. +2
- From the peptide chain: Met-Tyr-Phe-Arg-Ile-Glu-Asn-Asp-Ser, draw the structure of the product formed when reacted with ElastaseConsider the following peptide: Lys-Tyr-Glu-His-Arg-Ala-Asp-Arg-Glu-Tyr-Lys a) What is the net charge of this peptide at pH=1? Show your work. b) What is the net charge of this peptide at pH=14? Show your work.you have the following peptide Arg-Ile-Pro-Leu-Asp-Lys-Glu The net charge on this peptide at pH 7.0 is ?. The net charge on this peptide at 1M HCl is ?.
- Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-TyrDraw a peptide for cys-asn- pro-gly (Using the same format in picture)Given the peptide Lys-Glu-Trp a) Draw the appropriate titration curve for this peptide. Label X and Y axis b) On the graph use X to mark point at which peptide have 0 net charge and Y to mark point where peptide have positive 1 net charge