Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…
A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…
Q: Match the enzymes/proteins with their role in translation
A: In molecular biology and genetics, translation refers to the process by which ribosomes in the…
Q: Define the term messenger RNA (mRNA)?
A: Transcription and translation are 2 steps involved in processing of DNA to proteins. RNA molecule is…
Q: Rank the following in order of size: tRNA, DNA, mRNA.
A: A transfer RNA (tRNA) is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in…
Q: The ribosome binds to the mRNA molecule to start translation of its code into a protein. What…
A: Step 1 The translation is the process in which the coded genetic message brought by mRNA (messenger…
Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…
A: Translation is a process in which protein is synthesized from the information contained in a…
Q: A. What organelle is responsible for Translation?
A: Protein synthesis is the process of creating protein molecules. It involves amino acid synthesis,…
Q: What enzyme is responsible for forming peptide bonds between amino acids? Aminoacyl-tRNA synthetase.…
A: Translation is the process of synthesis of protein in the cytoplasm.
Q: Describe the function of mRNA, rRNA and tRNA.
A: Functions of mRNA, rRNA and tRNA: DNA has the genetic information stored in it. This information has…
Q: List the 4 types of RNA degradation and describe each in 1 sentence
A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…
Q: Codons are found on __________ and they contain __________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3…
A: Codons are found on mRNA and they contain 3 bases. The genetic code is the stored genetic…
Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand
A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).
Q: In translation, the information in a mRNA transcript is used to build a polypeptide chain (protein).…
A: Translation the cellular process of formation of a polypeptide chain from the amino acids coded by…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA…
A: DNA is made up of 4 bases A, T, G, and C. A Pairs with T and G pairs with C. In the case of RNA, the…
Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…
A: The synthesis of a functional protein involves two processes namely transcription and translation.…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…
Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…
A: Translation is the process of formation of amino acids from mRNA sequence.
Q: Use the genetic code to complete the following table. Assume m that reading is from left to right…
A: In DNA double helix Adenine (A) pairs with Thymine(T) and Guanine (G) pairs with Cytosine (C).…
Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…
A:
Q: The N-terminal signal sequence of a protein is involved in which of the following processes? Protein…
A: A peptide has two ends are N and C terminal. The terminal with a free amino group is known as…
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: Define replication, transcription, and translation.
A: Deoxyribonucleic acid is the genetic material present inside the nucleus of a cell. The cell…
Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…
A: The cell biology is considered as the study of cells, their structure, and their functions. The…
Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.
A: Answer
Q: An mRNA molecule codifies only one type of protein?
A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…
Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…
A: In order for a gene to be converted into a functional protein, two processes must take place namely…
Q: Explain how mRNA and tRNA work together to get amino acids into their correct places in the protein.
A: The translation is a process through which the polypeptide chain is synthesized based on the…
Q: Using the genetic code, interpret the following set of nucleotides.…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: A simplified model of protein synthesis is shown here. How might this model be revised to show a…
A: The model shows central dogma of molecular biology
Q: Why is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed…
A: Replication is considered as the process, during which DNA is replicated into DNA, which is after…
Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…
A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…
Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG
A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…
Q: The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a…
A: The primary structure simply means the sequence of amino acids in a polypeptide chain. By the…
Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…
A: Transcription and translation are two processes of gene expression. The process of the formation of…
Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…
A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…
Q: Which of the following molecules is (are) produced by translation? N A. RNA polymerase B. The…
A: The translation is a process of synthesis of proteins from the messenger RNA (mRNA). It is achieved…
Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1
A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…
Q: Describe the specificity between the amino acid carried by a tRNA and a codon in mRNA.
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: The relaxation of base-paring rules between the TRNA and mRNA is termed as Answer:
A: Introduction: Ribonucleic acid or RNA is the type of nucleic acid that is mainly present in the…
Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…
A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…
Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…
A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…
Q: Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a…
A: The nucleotides are formed by crosslinking three chemicals namely orthophosphoric acid (H3PO4),…
Q: of the following determines the amino acid sequence of the protein produced during the process of…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…
A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…
Q: Define the following terms: a. proteomics b. translation c. genetic code d. antibiotic resistance e.…
A: Gene expression can be defined as the process that uses genetic information for the synthesis of any…
Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…
A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…
help
Step by step
Solved in 2 steps
- Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.Using the central dogma of molecular biology, explain the terms replication, transcription and translationDoes lysyl-tRNA synthetase have a proofreading capability? If so, what are other amino acids can you predict that fit into the active site and may get hydrolyzed
- Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
- Difference between red-labelled and green-labelled cDNA preparations.Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered
- Fill the gap Molecular programming, also known as ........ exploits the information-processing capabilities of nucleic acids to design ....... at the nanoscale.Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’