Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' DNAS' DNA3' RNAS Question 3.2. Depict the mRNA transcript in the below RNAS' MRNAS' Question 3.3. Translate the mRNA MRNA5' Protein in
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: Splice sites are recognized by GU (5' splice site) and AG (3' splice site), which signals the…
Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…
A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…
Q: Answer the following: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…
A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…
Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…
A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…
Q: What is the sequence in the template DNA strand during RNA production that encodes the codon GCU?…
A: Translation is the process of formation of mRNA transcript on DNA template strand.
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: Transcription factors are the class of nuclear proteins that facilitate transcription. It is studied…
Q: he correct mRNA strand and amino acid sequence into the appropriate boxes to represent how the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…
A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…
Q: Fill in the blanks (NO PARAGRAPHS ONLY SHORT ANSWERS) Normal DNA: TGC GTG CTT AAG CGG TGT…
A: m RNA of the normal DNA will be:- ACG CAC GAA UUC GCC ACA UGU GCA ACG Amino acid coded will be (in…
Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…
A: Please follow step 2 for detailed explanation.
Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…
A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…
Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…
A: DNA undergoes the process of transcription to copy itself into RNA. The segments of RNA that can be…
Q: What type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertion
A: Nicholas’s disease Nicholas’s disease is broadly known as the sickle cell disease. In this disease,…
Q: Question 1 Capping a pre-MRNA transcript and adding poly-A tail to its 3' end occurs in A eukaryotic…
A: Poly A tail is added to 3' end of the pre- mRNA once elongation is complete. The polyA tail…
Q: Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the…
A: In molecular biology the central dogma states the transcription and translation process in order to…
Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…
A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…
Q: Choose the correct answer. The primer bind the 16S TDNA in one of its conserved / variable regions.
A: 16S ribosomal RNA is composed of RNA of the 30S subunit of a prokaryotic ribosome. They have two…
Q: Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two…
A: sickel cell anemia is a type of anemia in which the red blood cells are abnormally shaped and…
Q: Match the terms with the best description.____ genetic message a. protein-coding…
A: A gene is a specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and…
Q: Part 1: transcription (DNA- mRNA) 1. You are now inside of a cell, looking at a strands of DNA. Look…
A: Genes are the functional segments of DNA.
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…
Q: Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a…
A: The mutation is simple known to state towards the a term that used to describe a change in the…
Q: Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need…
A: Introns -- Introns are described as nucleotide sequences in DNA and RNA ,do not directly code for…
Q: Below is an electron micrograph illustrating the process of simultaneous transcription and…
A: Prokaryotic cells are unicellular and they lack a nuclear membrane. Due to this, transcription and…
Q: From what DNA base sequence was the following mRNA sequence transcribed? 5’ – UUCGAG – 3’
A: If the 5'-UUCGAG-3' is the the sequence for mRNA, then the DNA base sequence will be 3'-AAGCTC-5'
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…
Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…
A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…
Q: An R loop experiment was performed on two different mRNA's. The first showed one R loop, while the…
A: Eukaryotic mRNA is transcribed post-transcriptionally to form mature mRNA. The post-transcriptional…
Q: Which is the mRNA molecule that would be transcribed from this DNA template:…
A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…
Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: The intron boundary (5' splice site) generally starts with GU sequence. The consensus sequence of 5'…
Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.
A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.
Q: Indicate the differences between the coding and non-protein coding RNA.* Write the answer.
A: The information for synthesis of functional proteins is stored in DNA (Deoxyribonucleic acid). A…
Q: Why must mRNAs contain the nucleotides AUG? Question 37 options: A) to bind the Shine-Dalgarno…
A: The AUG codon codes for methionine. It is the most common start codon, specifyinh the amino acid at…
Q: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base…
A: Central Dogma It is the process by which the instructions in DNA are converted into a functional…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: Transcription and translation both involve an initiation, elongation, and termination phase.…
A: Answer (1) :- Fragments of DNA that are responsible for different traits are known as genes. The…
Q: 2 3 3' 5' ATGACGGATC UACUGCCUAGUC 5 SCAAGCGGAATTGGCGACATAA GCGUU 3…
A: Genetic information is transferred from DNA to the proteins via RNA by the process of transcription…
Q: Discuss DNA to RNA transcription in a simple way (
A: Definition : Process of copying a segment of DNA into RNA is known as Transcription. In simple,…
Q: Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U…
A: Question - Refer to the genetic code table and the mRNA sequence below to complete this question: U…
Q: Please choose the correct answer. Which of the following statements is NOT true about reverse…
A: Which of the following statements is NOT true about reverse transcription The correct answer would…
Q: GENE B DNA ACCCAACA A MRNA Amino Acid
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.
Q: QUESTION 1 RNA Polymerase is the enzyme responsible for DNA replication O True False QUESTION 2 RNA…
A: As per the guidelines we are supposed to answer only the first question in case of multiple posted.…
Q: Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b)…
A: UTR stands for untranslated region in mRNA.
Q: For each of the following RNA molecules: Indicate if it is Required or Not for translation in…
A: Question) Indicate if it is Required or Not for translation in prokaryotes and, if it is required,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
- Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to cross nucleosomes during extension is:a. SWI-SNFb. poly A polymerasac. TFIISd. FACT 2. The polydenylation is carried out by:a. primaseb. polymers poly ac. a reverse transcriptased. adenylyltransferase 3. The lactose operon produces a polycistronic mRNA that includes four genes: Lacl, LacZ, LacY and LacA. True or false?Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
- Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
- ⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: 2. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are two ATG’s. From which the translation can be initiated.⦁ 1st ATG⦁ 2nd ATG⦁ None⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: ⦁ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?