Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein coding mRNA including the untranslated regions (UTRS) Cap 5'.UTR Start Poly-A tail Coding sequence (CDS) 3' UTR Stop 5' 3' Question 1: Which of the following mutations may result in synthesis of a non- functional protein? A. Silent mutation in the coding sequence. B. Missense mutation in the coding sequence C. Deletion of four bases in the 5'-UTR Deletion of four bases in the 3'-UTR

Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein coding mRNA including the untranslated regions (UTRS) Cap 5'.UTR Start Poly-A tail Coding sequence (CDS) 3' UTR Stop 5' 3' Question 1: Which of the following mutations may result in synthesis of a non- functional protein? A. Silent mutation in the coding sequence. B. Missense mutation in the coding sequence C. Deletion of four bases in the 5'-UTR Deletion of four bases in the 3'-UTR

Name: Effect of DNA Mutations on Protein Structure & FunctionThe structure
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Effect of DNA Mutations on Protein Structure & FunctionThe structure of a typical human protein coding mRNA including the untranslated regions (UTRS)Сap 5' UTRCoding sequence (CDS)Poly-Atail3' UTRStartStop5'3'Question 1:Which of the following mutati

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter31: Completing The Protein Life Cycle: Folding, Processing, And Degradation

Section: Chapter Questions

Problem 8P

See similar textbooks

Similar questions

3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled â€˜Biological Assembly.â€� click â€œMore Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
Question:- Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E coll release factors 1 and 2 (RF1 and RF2) c. 5' methyl-guanosine cap d. Ribosomal P site
Genetics of man question:Provide the expression pattern of the gene ,GATA binding 3 (GATA3).
4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3' b) How many different mRNA sequences could code for the protein sequence you determined in 4a? Explain how you came up with your answer (don't write out all the possible mRNA sequences - just explain your logic). Can you help with 4a and sub question b
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGA
Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.