Translation a. In the diagram above, draw a rectangle around the part that represents translation. (Ck edit. Draw a rectangle using the features in the drawing section.) b. "In your own words, describe the process of translation, step by step. C. Explain why this process must occur where it does in the cell.

Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…

A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…

Q: describe the process of translation/protein synthesis at the ribosome based on these figures

A: Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…

A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.

Q: Define the transcription unit. How does it differ from the gene? Describe how you would determine…

A: Succession of nucleotides in DNA that codes for a solitary RNA particle, alongside the arrangements…

Q: Transfer RNA serve as interpreters during translation- EXPLAIN

A: tRNA or transfer RNA brings amino acids sequence from the cytoplasm. It acts as a connector which…

Q: Using the central dogma of molecular biology, explain the terms replication, transcription and…

A: The functional unit of heredity is described as the gene that is made up of DNA. A gene is expressed…

Q: Arrange the following components of translation in the approximate order in which they would appear…

A: In prokaryotes, the protein synthesis takes place in the cytoplasm. It comprises two steps…

Q: Matching type: Choose the effect of the given agents to translation or transcription  Choices: RNA…

A: Transcription and translation are the processes by which a gene can express itself in the form of…

Q: In describing the triplet binding assay, an undergraduate with limited knowledge of translation…

A: Every three nucleotides in a row count as a triplet in the genetic code and codes for a single amino…

Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…

A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…

Q: Describe in detail the steps of translation termination in bacteria. Explain what happe

A: For the synthesis of a polypeptide with a defined sequence, two fundamental chemical requirements…

Q: RNA sequence of A gene       If we have the following mutations, find the type of the mutation…

A:

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: m

A: DNA → RNA RNA → protein

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: Translation initiation efficiency can be regulated by which of the following: The affinity of the…

A: Note- we are supposed to answer 1 question according to our guidelines. Please repost the other…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Describe what is happening at each of the four stages of translation shown in the above diagram-

A: The translation is a process by which the genetic code contained within a messenger RNA molecule is…

Q: 5’      UUGCAUUGCAGC    3’    Write out ALL of the possible reading frames for the RNA shown in…

A: The DNA acts as the genetic material of a living organism. This DNA generally gets replicates to…

Q: create a summary of the nucleotide pairs during the translation process

A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…

Q: In Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?

A: t-RNA is responsible to bring the amino acids to the site of protein synthesis. t-RNA is charged…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A:

Q: Describe in Your own words the Termination step of Translation process

A: Proteins are polypeptide molecules synthesized by the translation of mRNA in the ribosome.…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…

A: Gene expression includes transcription  and translation. It leads to synthesize mRNA and protein…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…

A: DNA replication is the process by which a single DNA strand will produce two identical daughter…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: translation

A:

Q: what is the genetic code and explain the properties

A: Hi! Thanks for your question. But as you have posted multiple subpart questions, I am answering the…

Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…

A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine

Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…

A: DNA replication is the process of generating two identical copies from the original DNA strand. The…

Q: b. Translation translation is the process of generating polypeptide using the information carried on…

A: Flow of information in the DNA involves DNA RNA and proteins. Proteins are the ultimate machinery…

Q: Translation. Write the anti-codon sequence of the mRNA transcript. Translate the MRNA transcript…

A:

Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…

A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…

Q: Methionine is used as the first amino acid for a particular polypeptide, but it is removed during…

A: The synthesis of proteins from the m RNA is called translation.

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription  Formation of RNA over DNA template is called transcription.  Translation The process…

Q: TACGGTACGATT CYTOPLASM Transcription a. On the diagram, draw a circle around the part that…

A:

Q: Using the table on the other page- transcribe the RNA sequence into codons and their amino acids:…

A: Given: Codons are given, have to tell which amino acid they code for. DNA => transcription =>…

Q: Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular…

A:

Q: Briefly, describe one mode of post-translational modification that occurs once translation is…

A: Following protein biosynthesis, post-translational modification refers to the covalent and usually…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.