DNA polymerase III in bacteria is responsible for initiating DNA replication by adding nucleotides O to the 5' end of an RNA primer on single-stranded templates without the need for an RNA primer O in a 3' to 5' direction in the place of the primer RNA after it is removed O to the 3' end of an RNA primer

DNA polymerase III in bacteria is responsible for initiating DNA replication by adding nucleotides O to the 5' end of an RNA primer on single-stranded templates without the need for an RNA primer O in a 3' to 5' direction in the place of the primer RNA after it is removed O to the 3' end of an RNA primer

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
The following sequence of nucleotides is found in a single-stranded DNA template:ATTGCCAGATCATCCCAATAGATAssume that RNA polymerase proceeds along this template from left to right a. Which end of the DNA template is 5′ and which end is 3′?b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template
The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding the DNA during replication. to induce tighter coiling in supercoils. to remove the RNA primers from the lagging strand at each Okazaki fragment to start unwinding and separate the DNA to initiate replication to provide energy to remove a diphosphate fragment from each nucleoside triphosphate.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
A deamination occurs on the cytosine residue in the following DNA sequence. This cytosine residue happens to be methylated on the 5-position of the aromatic ring. 5'-GCATGG-3'. (Note: the top strand is shown; this is the strand where the deamination occurs.) If the mutation is not repaired, and a round of DNA replication occurs, then the sequence of the newly- replicated complementary strand (i.e., the bottom strand) will be: A. 5'-CCATGC-3 B. 5'-CCATAC-3' C. 5'-CATACC-3' D. 5'-GTATGG-3' E. None of the above
The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome assembly B. 5’→ 3’ polymerase C. 3’ → 5’ exonuclease and proof-reading D. sliding clamp
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
Telomerase adds six deoxynucleotides to the end of a DNA strand using a built-in RNA template. Explain why the templating region of the RNA includes one and a half repeats of the telomeric sequence (∼9 nucleotides).