Do you think it is possible that interchain disulfide bonds is present in the protein? Explain. b.  Do you think it is possible that intrachain disulfide bonds is present in the protein? Explain.

Q: Consider five proteins with the properties shown in the following table. Answer the questions below…

A: Protein is an organic nitrogenous macromolecule that is essential for the health of humans. In the…

Q: Consider the peptide with the sequence SANTACLAUSISASTALKER. Assume this entire pepide were a single…

A: Proteins are the heteropolymers of amino acids. The proteins are made up of twenty standard amino…

Q: Leni, Isko and Ping are trying to determine the molecular weight of their crude protein samples…

A: SDS-PAGE (sodium dodecyl sulphate–polyacrylamide gel electrophoresis), is a discontinuous…

Q: Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in…

A: Biuret test is a test used for detecting the presence of peptide bonds. Biuret Reagent is  formed by…

Q: Which of the following is most commonly the rate limiting step in determining the structure of a…

A: X-ray crystallography (XRC) is a widely used experimental technique to determine the macromolecule…

Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…

A: BLAST is a computer algorithm that is available for use online at the National Center for…

Q: Which of the following is not one of the basic features used in protein separation techniques? a.…

A: Protein separation is a series of cycles proposed to disengage one or a couple of proteins from a…

Q: n as1 mutant, assign secondary structure and tell how many alpha helices and beta-pleated sheets…

A: Primary Structure: It is defined as a linear sequence of amino acids joined to each other through a…

Q: A scientist wants to create a new enzyme for the synthesis of a new small molecule that will be used…

A: Introduction Possible arrangements can be calculated using the combinations formula,  nCr=…

Q: What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in…

A: Protein is a substance formed of amino acids joined by peptide bonds. Nucleic acid - are compounds…

Q: . Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: In disulfide linkage, the two cysteine amino acids are joined by a disulfide bond.

Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: Disulfide bonds are considered the covalent bond, which is formed between the two cysteine residues.…

Q: Is RNA-binding enzyme RNase A more likely to have a pI of 9.2 or 5.0?Briefly explain your reasoning.

A: Ribonuclease A (RNase A) is a digestive enzyme secreted by the pancreas that specifically digests or…

Q: A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids…

A: In the given case both the proteins can be of related population so, the proteins can be related by…

Q: A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids…

A: Introduction Stating evolutionary relationships between two proteins or their domain still leaves a…

Q: Adult hemoglobin is a multimeric protein with fourpolypeptides, two of which are α-globin and two…

A: Haemoglobin is a protein that is responsible for oxygen transport in most of the vertebrates.  This…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…

A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…

Q: The effect of base-pair substitution mutations on protein function varies widely from no detectable…

A: A mutation is any alteration in the nucleotide sequence that changes the sequence of DNA, RNA and…

Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…

A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…

Q: A common strategy for identifying distantly relatedhomologous proteins is to search the database…

A: Introduction: Bioinformatics is an interdisciplinary field of science that combines biology,…

Q: B. For each of the following amino acid sequences in the protein, predict the most likely secondary…

A: "Since you have asked multiple questions, we will solve the B question for you. If you want a…

Q: a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for such…

A: Tetramer - A tetramer is an oligomer formed from four monomers or subunits.

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: You are trying to isolate a protein you don't know much about, so you decide to use a gel column…

A: Introduction :-  Chromatography is a biophysical technique which is used to separate or isolate the…

Q: You are in the process of determining theamino acid sequence of a protein and must reconcile…

A: In the first trial, the protein has glycine at the amino terminal while asparagine at the carboxyl…

Q: - (a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for…

A: (a) A tetramer could have a heterologous interaction that would give rise to a C4 symmetry as well…

Q: A protein chemist told a molecular geneticist that he had found a new mutant hemoglobin in which…

A: A codon is a group of three consecutive nucleotides that specify an amino acid. Four different…

Q: Imagine a globular protein with a histidine that is involved in a salt bridge to an aspartic acid,…

A: Globular proteins are a group of protein sub-types. They form colloids  and are somewhat soluble in…

Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…

A: Proteins are amazing molecules that make everything simple inside the cell. Protein molecules are…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…

A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…

Q: (a) A protein is found to be a tetramer of identical subunits. Name two symmetries possible for such…

A: Tetramer : It is an oligomer formed from four monomers or subunits. The associated property is…

Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…

A: introduction

Q: A. What change should disrupt the interaction between proteins 1 and 2 the most? Why? B. What…

A: Introduction: Proteins are the polymers of L-α-amino acids. Proteins plays an important role in the…

Q: Describe the planar sections of the primary sequence, their influence on the shape of the protein…

A: Amino acids are the building blocks of proteins. These are compounds containing Carbon, Hydrogen,…

Q: What is the function of the molecular chaperone? What would happen to the protein if molecular…

A: According to the question we have to give the function of the molecular chaperon. In addition to…

Q: How can widely separated parts of a protein interact with the spike protein

A: Spike proteins are glycoproteins that are present on the surfaces of the enveloped viruses of many…

Q: Below is a sequence of DNA.…

A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…

Q: Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are…

A: Given: molar mass = 5.0×105 g/mol = 500000 g/mol average molecular weight of an amino acid = 100…

Q: . Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be…

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: What kinds of amino acids would you expect to find in the 7th transmembrane spanning segment…

A: Transmembrane proteins are membrane proteins that span the entire membrane. They can have single or…

Q: and Arg29 is important in determining the structure of the protein. a) What type of amino acid is…

A: This is a question about protein fold and the importance of amino acids in folding.

Q: • In a globular protein, where would you expect the nonpolar regions to be located? Whereabouts…

A: Proteins are classified into two main groups based on their Molecular shape. They are 1) Globular…

Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…

A: The genetic code is a system of principles that live cells employ to convert data contained in…

Q: Can you describe the ensemble allostery model and explain how it is used to explain allostery in…

A: In allosteric regulation binding of a ligand to one of the subunit enhances or decreases the binding…

Q: Give two reasons to explain why a proline residue in the middle of an αhelix is predicted to be…

A: Proline is an organic acid classed as a proteinogenic amino acid contains a secondary amine.