You are trying to isolate a protein you don't know much about, so you decide to use a gel column chromatography. You do as much research on this protein as possible and realize that this protein contains A LOT of aspartic acid and glutamic acid. Knowing this, what column would you choose, and which tube would you expect to find your protein (the first tube or the last tube)?

You are trying to isolate a protein you don't know much about, so you decide to use a gel column chromatography. You do as much research on this protein as possible and realize that this protein contains A LOT of aspartic acid and glutamic acid. Knowing this, what column would you choose, and which tube would you expect to find your protein (the first tube or the last tube)?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You gathered your data from Lab 4, and found the following values: Total Activity of lysozyme in HEW: 14 units Total Activity of lysozyme in carb 1: 21 units Total amount of protein in HEW: 70 mg Total amount of protein in Carb 1: 15 mg Calculate the extent of purification of lysozyme in Carb 1. 150% 7 fold 70% 15 fold
Adult hemoglobin is a multimeric protein with fourpolypeptides, two of which are α-globin and two ofwhich are β-globin.a. How many genes are needed to define the structureof the hemoglobin protein?b. If a person is heterozygous for wild-type allelesand alleles that would yield amino acid substitutionvariants for both α-globin and β-globin, how manydifferent kinds of hemoglobin protein would befound in the person’s red blood cells and in whatproportion? Assume all alleles are expressed at thesame level.
What Architectural Arrangements Characterize ProteinStructure?
Are all the proteins separated properly using SDS-PAGE? Why or why not?
are all the protein separated properly using isoelectric focusing? why or why not?
How is it that protein–protein interactions thatare too weak to cause proteins to assemble in solutioncan nevertheless allow the same proteins to assemble intocomplexes on DNA?
Can you please identify what type of protein this is?
In order to prepare a standard curve, you will do serial dilutions of the standard protein. Assume the protein concentration in tube A is 3 mg/ml and you take 0.5ml and add it to the next tube (tube B) containing 0.5ml of buffer. What is the concentration in tube B?
If you have the same protein loaded in two different lanes of an SDS-PAGE stained with Coomasie blue, and one lane has a darker, thicker band of protein than the other lane, can you say that there is more protein in the lane with the darker band? Why or why not?
Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
When a protein was denatured and lost its function due to its spatial structures were disrupted. Which of the following was disrupted during the denaturing process?
How do you identify the N vs C terminals? For the first part of the question, do you then list the amino acids in order clockwise from N terminal to C terminal?